Multiple sequence alignment - TraesCS3B01G301500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G301500 chr3B 100.000 2378 0 0 1 2378 483372716 483375093 0 4392
1 TraesCS3B01G301500 chr1A 98.613 2380 31 2 1 2378 238109345 238106966 0 4211
2 TraesCS3B01G301500 chr1A 98.613 2380 31 2 1 2378 238154730 238152351 0 4211
3 TraesCS3B01G301500 chr5A 98.529 2380 33 2 1 2378 16577520 16575141 0 4200
4 TraesCS3B01G301500 chr7A 98.487 2380 34 2 1 2378 60328610 60326231 0 4194
5 TraesCS3B01G301500 chr6B 98.403 2380 32 4 1 2378 596656906 596654531 0 4180
6 TraesCS3B01G301500 chrUn 98.025 2380 39 4 1 2378 237257430 237255057 0 4128
7 TraesCS3B01G301500 chr7D 98.062 2374 41 3 1 2372 579015978 579018348 0 4124
8 TraesCS3B01G301500 chr1B 97.815 2380 47 5 1 2378 672508150 672505774 0 4102


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G301500 chr3B 483372716 483375093 2377 False 4392 4392 100.000 1 2378 1 chr3B.!!$F1 2377
1 TraesCS3B01G301500 chr1A 238106966 238109345 2379 True 4211 4211 98.613 1 2378 1 chr1A.!!$R1 2377
2 TraesCS3B01G301500 chr1A 238152351 238154730 2379 True 4211 4211 98.613 1 2378 1 chr1A.!!$R2 2377
3 TraesCS3B01G301500 chr5A 16575141 16577520 2379 True 4200 4200 98.529 1 2378 1 chr5A.!!$R1 2377
4 TraesCS3B01G301500 chr7A 60326231 60328610 2379 True 4194 4194 98.487 1 2378 1 chr7A.!!$R1 2377
5 TraesCS3B01G301500 chr6B 596654531 596656906 2375 True 4180 4180 98.403 1 2378 1 chr6B.!!$R1 2377
6 TraesCS3B01G301500 chrUn 237255057 237257430 2373 True 4128 4128 98.025 1 2378 1 chrUn.!!$R1 2377
7 TraesCS3B01G301500 chr7D 579015978 579018348 2370 False 4124 4124 98.062 1 2372 1 chr7D.!!$F1 2371
8 TraesCS3B01G301500 chr1B 672505774 672508150 2376 True 4102 4102 97.815 1 2378 1 chr1B.!!$R1 2377

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
722 724 3.947834 CCTATCCAGAAAAATTGTCGGCT 59.052 43.478 0.0 0.0 0.0 5.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1751 1755 1.169661 AAAGCGCGAACCAACATCCA 61.17 50.0 12.1 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 6.208644 GCATTGGTTTGCTAAATCGACATAT 58.791 36.000 0.00 0.00 39.57 1.78
151 152 4.360889 AGAACCTCAGATTGATGGAGTCT 58.639 43.478 0.00 0.00 0.00 3.24
722 724 3.947834 CCTATCCAGAAAAATTGTCGGCT 59.052 43.478 0.00 0.00 0.00 5.52
898 902 5.136068 TGGTCCATGATGGCCTTTTATTA 57.864 39.130 20.41 2.06 37.47 0.98
1210 1214 0.955428 TGCTCACATTCCAGGCGAAC 60.955 55.000 0.00 0.00 31.79 3.95
1334 1338 2.101917 TGGGAATTCCGGATCGTAGAAC 59.898 50.000 18.30 0.46 38.34 3.01
1697 1701 4.355549 ACAATGTGTCCCCATGATCATTT 58.644 39.130 5.16 0.00 32.21 2.32
1705 1709 6.260936 GTGTCCCCATGATCATTTACTTACAG 59.739 42.308 5.16 0.00 0.00 2.74
1706 1710 6.157820 TGTCCCCATGATCATTTACTTACAGA 59.842 38.462 5.16 0.00 0.00 3.41
1832 1836 7.437713 AGGATTGTTCATGGAACTACTATCA 57.562 36.000 10.14 0.00 42.39 2.15
1938 1942 5.895636 ATGGCATTTGTTGTCTTATTCGA 57.104 34.783 0.00 0.00 0.00 3.71
2118 2122 2.540101 CCGAAGACATAATTGCGGAGTC 59.460 50.000 0.00 0.00 41.11 3.36
2169 2173 2.462723 AGTAGGCACTCCTCTTCCTTC 58.537 52.381 0.00 0.00 43.06 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 7.119709 TCGAACCCATGATACAATCTTCTTA 57.880 36.000 0.00 0.00 0.00 2.10
151 152 1.132453 CAGCTATTCTGTCCGACGACA 59.868 52.381 0.00 0.00 46.91 4.35
194 195 2.306847 GCACCAAGAACAAGAAAGGGA 58.693 47.619 0.00 0.00 0.00 4.20
420 422 1.946768 CAGTCCAGCAAGAAAACGGAA 59.053 47.619 0.00 0.00 0.00 4.30
644 646 5.221661 ACCGAGTGGAATCAAAGAAACTAGT 60.222 40.000 0.00 0.00 39.21 2.57
722 724 2.419021 GGGATCGGAACCACATTCGTAA 60.419 50.000 6.63 0.00 38.31 3.18
898 902 8.206867 TCATAGAGAGATCCAATCGTCAAAATT 58.793 33.333 0.00 0.00 0.00 1.82
1210 1214 4.271049 AGAATGTTCCTGCGAATTATGACG 59.729 41.667 0.00 0.00 0.00 4.35
1334 1338 4.641396 TGCACCATATTTAGATCTTCCCG 58.359 43.478 0.00 0.00 0.00 5.14
1564 1568 1.202568 GCTTTTTGTGGCTTCCTGCTT 60.203 47.619 0.00 0.00 42.39 3.91
1705 1709 9.103861 AGAATGAGGAAGAAAAAGATATCGTTC 57.896 33.333 4.30 6.55 33.62 3.95
1706 1710 9.454859 AAGAATGAGGAAGAAAAAGATATCGTT 57.545 29.630 0.00 0.00 0.00 3.85
1751 1755 1.169661 AAAGCGCGAACCAACATCCA 61.170 50.000 12.10 0.00 0.00 3.41
1832 1836 8.977412 ACTTGGAAATATGGTCCGAATAATTTT 58.023 29.630 2.15 0.00 38.06 1.82
2058 2062 1.483595 TTCCTGCTGGAGGTCTGGTG 61.484 60.000 15.24 0.00 44.24 4.17
2118 2122 6.743575 ATATTCTTTCAACCTTGGAAGTCG 57.256 37.500 6.05 0.00 43.00 4.18
2169 2173 1.649664 CGCAGATTCACCTTCCTCTG 58.350 55.000 0.00 0.00 38.49 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.