Multiple sequence alignment - TraesCS3B01G288400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G288400 chr3B 100.000 2499 0 0 1 2499 463094936 463097434 0.000000e+00 4615
1 TraesCS3B01G288400 chr3B 90.683 161 14 1 256 416 764080585 764080744 1.950000e-51 213
2 TraesCS3B01G288400 chr3A 99.600 2499 7 2 1 2499 477562196 477564691 0.000000e+00 4556
3 TraesCS3B01G288400 chr3A 77.728 449 59 19 1 416 710101112 710100672 1.160000e-58 237
4 TraesCS3B01G288400 chr1B 80.769 598 98 14 513 1099 8675291 8675882 3.790000e-123 451
5 TraesCS3B01G288400 chr1B 85.641 195 24 4 229 420 8674950 8675143 4.210000e-48 202
6 TraesCS3B01G288400 chr1A 81.781 483 80 8 1361 1838 7659003 7658524 5.010000e-107 398
7 TraesCS3B01G288400 chr1A 91.667 144 11 1 277 420 7660130 7659988 5.450000e-47 198
8 TraesCS3B01G288400 chr4A 84.300 293 45 1 515 807 669443091 669442800 4.070000e-73 285
9 TraesCS3B01G288400 chr1D 88.442 199 21 2 903 1099 6334097 6333899 3.210000e-59 239
10 TraesCS3B01G288400 chr1D 89.634 164 14 3 259 420 6334839 6334677 3.260000e-49 206
11 TraesCS3B01G288400 chr5A 85.276 163 22 2 259 419 619177491 619177329 1.540000e-37 167
12 TraesCS3B01G288400 chr5B 84.568 162 24 1 259 419 611646547 611646386 2.570000e-35 159
13 TraesCS3B01G288400 chrUn 86.429 140 19 0 277 416 231451802 231451941 1.200000e-33 154


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G288400 chr3B 463094936 463097434 2498 False 4615.0 4615 100.000 1 2499 1 chr3B.!!$F1 2498
1 TraesCS3B01G288400 chr3A 477562196 477564691 2495 False 4556.0 4556 99.600 1 2499 1 chr3A.!!$F1 2498
2 TraesCS3B01G288400 chr1B 8674950 8675882 932 False 326.5 451 83.205 229 1099 2 chr1B.!!$F1 870
3 TraesCS3B01G288400 chr1A 7658524 7660130 1606 True 298.0 398 86.724 277 1838 2 chr1A.!!$R1 1561
4 TraesCS3B01G288400 chr1D 6333899 6334839 940 True 222.5 239 89.038 259 1099 2 chr1D.!!$R1 840

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
416 420 8.398665 GGTTAACATCTTTAGCAATTGAGGTAG 58.601 37.037 10.34 0.83 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1958 2162 5.695816 GGAGAGCAGCTCTTGAATATTACTG 59.304 44.0 26.11 0.0 41.35 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
416 420 8.398665 GGTTAACATCTTTAGCAATTGAGGTAG 58.601 37.037 10.34 0.83 0.00 3.18
1958 2162 4.989168 CCTACTGGTTTTCTGTACAGTGAC 59.011 45.833 21.99 17.12 43.41 3.67
2445 2649 2.533266 ATGAACAGACGTTGCAGAGT 57.467 45.000 0.00 0.00 34.75 3.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
416 420 8.748380 AACAAAGATATAGAACAAAAGCAAGC 57.252 30.769 0.00 0.0 0.00 4.01
483 487 5.654650 TGTTCTAGCCTGAAGTTTCCAAAAA 59.345 36.000 0.00 0.0 0.00 1.94
1958 2162 5.695816 GGAGAGCAGCTCTTGAATATTACTG 59.304 44.000 26.11 0.0 41.35 2.74
2445 2649 2.904866 GCAACGTCCCAGCCACAA 60.905 61.111 0.00 0.0 0.00 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.