Multiple sequence alignment - TraesCS3B01G287500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G287500 chr3B 100.000 2465 0 0 1 2465 460381857 460379393 0.000000e+00 4553.0
1 TraesCS3B01G287500 chr7B 97.738 2476 41 6 1 2465 568667223 568664752 0.000000e+00 4248.0
2 TraesCS3B01G287500 chr7A 94.290 2417 85 17 94 2464 708789161 708791570 0.000000e+00 3650.0
3 TraesCS3B01G287500 chr7A 92.938 354 25 0 1279 1632 122055 122408 1.310000e-142 516.0
4 TraesCS3B01G287500 chr7A 84.444 315 33 8 1805 2118 7493908 7493609 1.850000e-76 296.0
5 TraesCS3B01G287500 chr7A 91.324 219 13 3 2248 2465 122407 122620 6.670000e-76 294.0
6 TraesCS3B01G287500 chr7A 83.761 117 18 1 2062 2178 127727290 127727405 2.590000e-20 110.0
7 TraesCS3B01G287500 chr2D 95.559 1396 51 9 3 1393 35057006 35055617 0.000000e+00 2224.0
8 TraesCS3B01G287500 chr2D 97.626 1011 19 2 1456 2465 35055618 35054612 0.000000e+00 1729.0
9 TraesCS3B01G287500 chr6D 95.047 1393 46 10 5 1393 364892143 364893516 0.000000e+00 2169.0
10 TraesCS3B01G287500 chr6D 97.626 1011 19 2 1456 2465 364893515 364894521 0.000000e+00 1729.0
11 TraesCS3B01G287500 chr6B 96.564 1106 30 5 1363 2465 651217517 651216417 0.000000e+00 1825.0
12 TraesCS3B01G287500 chr6B 90.306 1176 73 19 1 1138 651229715 651228543 0.000000e+00 1502.0
13 TraesCS3B01G287500 chr6B 92.513 187 13 1 1135 1321 651217704 651217519 1.450000e-67 267.0
14 TraesCS3B01G287500 chr2B 94.281 1189 58 7 1278 2465 282993759 282992580 0.000000e+00 1810.0
15 TraesCS3B01G287500 chr1D 95.619 525 23 0 479 1003 332594028 332594552 0.000000e+00 843.0
16 TraesCS3B01G287500 chr1D 85.519 511 35 17 5 482 332581186 332581690 4.730000e-137 497.0
17 TraesCS3B01G287500 chr1D 79.592 98 9 8 107 195 400152514 400152419 2.650000e-05 60.2
18 TraesCS3B01G287500 chr4A 84.490 677 84 12 1512 2178 546002245 546001580 0.000000e+00 649.0
19 TraesCS3B01G287500 chrUn 96.825 315 5 2 2152 2465 479143922 479143612 2.810000e-144 521.0
20 TraesCS3B01G287500 chr5D 85.443 474 48 12 1512 1974 199427722 199427259 7.980000e-130 473.0
21 TraesCS3B01G287500 chr5D 91.561 237 18 2 1280 1515 324970540 324970305 2.360000e-85 326.0
22 TraesCS3B01G287500 chr7D 84.034 476 50 16 1512 1974 587258027 587257565 3.760000e-118 435.0
23 TraesCS3B01G287500 chr5B 90.254 236 23 0 1280 1515 377389075 377388840 2.380000e-80 309.0
24 TraesCS3B01G287500 chr5B 86.441 118 13 3 2062 2178 453266291 453266406 2.570000e-25 126.0
25 TraesCS3B01G287500 chr5B 80.519 154 30 0 555 708 348581493 348581646 4.310000e-23 119.0
26 TraesCS3B01G287500 chr5B 100.000 28 0 0 168 195 703106087 703106060 4.000000e-03 52.8
27 TraesCS3B01G287500 chr3D 86.572 283 28 8 1512 1791 164938523 164938248 1.110000e-78 303.0
28 TraesCS3B01G287500 chr5A 89.076 238 25 1 1278 1515 423056748 423056512 6.670000e-76 294.0
29 TraesCS3B01G287500 chr1A 90.789 76 6 1 46 120 544363914 544363839 1.560000e-17 100.0
30 TraesCS3B01G287500 chr1A 100.000 28 0 0 168 195 292910545 292910518 4.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G287500 chr3B 460379393 460381857 2464 True 4553.0 4553 100.0000 1 2465 1 chr3B.!!$R1 2464
1 TraesCS3B01G287500 chr7B 568664752 568667223 2471 True 4248.0 4248 97.7380 1 2465 1 chr7B.!!$R1 2464
2 TraesCS3B01G287500 chr7A 708789161 708791570 2409 False 3650.0 3650 94.2900 94 2464 1 chr7A.!!$F2 2370
3 TraesCS3B01G287500 chr7A 122055 122620 565 False 405.0 516 92.1310 1279 2465 2 chr7A.!!$F3 1186
4 TraesCS3B01G287500 chr2D 35054612 35057006 2394 True 1976.5 2224 96.5925 3 2465 2 chr2D.!!$R1 2462
5 TraesCS3B01G287500 chr6D 364892143 364894521 2378 False 1949.0 2169 96.3365 5 2465 2 chr6D.!!$F1 2460
6 TraesCS3B01G287500 chr6B 651228543 651229715 1172 True 1502.0 1502 90.3060 1 1138 1 chr6B.!!$R1 1137
7 TraesCS3B01G287500 chr6B 651216417 651217704 1287 True 1046.0 1825 94.5385 1135 2465 2 chr6B.!!$R2 1330
8 TraesCS3B01G287500 chr2B 282992580 282993759 1179 True 1810.0 1810 94.2810 1278 2465 1 chr2B.!!$R1 1187
9 TraesCS3B01G287500 chr1D 332594028 332594552 524 False 843.0 843 95.6190 479 1003 1 chr1D.!!$F2 524
10 TraesCS3B01G287500 chr1D 332581186 332581690 504 False 497.0 497 85.5190 5 482 1 chr1D.!!$F1 477
11 TraesCS3B01G287500 chr4A 546001580 546002245 665 True 649.0 649 84.4900 1512 2178 1 chr4A.!!$R1 666

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
482 525 0.391793 CCTCCTTCCTTCGTCCAAGC 60.392 60.0 0.0 0.0 0.00 4.01 F
789 840 0.617413 CTCCACATGGCTCCTCTTGT 59.383 55.0 0.0 0.0 34.44 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1306 1363 1.550327 TCGACAAGATCAGCCACTCT 58.450 50.000 0.0 0.0 0.00 3.24 R
1683 1742 4.696479 ACAGATCCTTCAACACAGAGTT 57.304 40.909 0.0 0.0 42.42 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
162 177 1.349627 CCATGACAAGATCGTGCGC 59.650 57.895 8.68 0.00 42.28 6.09
275 290 1.530891 CCGCCCCTCTCCTTCGATA 60.531 63.158 0.00 0.00 0.00 2.92
482 525 0.391793 CCTCCTTCCTTCGTCCAAGC 60.392 60.000 0.00 0.00 0.00 4.01
542 585 2.032528 CAAGCCTTGCCACTCCGA 59.967 61.111 0.00 0.00 0.00 4.55
566 609 0.678950 CACTTTGGCCAAATCCGGTT 59.321 50.000 30.46 8.78 0.00 4.44
724 773 1.738099 GGCATTGACGACAGCGAGT 60.738 57.895 0.00 0.00 41.64 4.18
789 840 0.617413 CTCCACATGGCTCCTCTTGT 59.383 55.000 0.00 0.00 34.44 3.16
855 906 1.835494 TCCAAGTCAGGGTAGTCTCG 58.165 55.000 0.00 0.00 0.00 4.04
925 976 5.277250 TGTGGAGAACCTAACTCATGGATA 58.723 41.667 0.00 0.00 36.26 2.59
926 977 5.905331 TGTGGAGAACCTAACTCATGGATAT 59.095 40.000 0.00 0.00 36.26 1.63
1306 1363 1.621317 TCTTCCACATGTTCGGTGCTA 59.379 47.619 0.00 0.00 34.94 3.49
1323 1380 2.167281 TGCTAGAGTGGCTGATCTTGTC 59.833 50.000 0.00 0.00 0.00 3.18
1453 1510 4.142116 TGTTGGCTGGATCTATTGCAATTG 60.142 41.667 18.75 16.01 0.00 2.32
1683 1742 7.289310 TCTCTTTGGTGATTGGATTATATGCA 58.711 34.615 0.00 0.00 0.00 3.96
2268 2368 8.450578 AACAAACTGTAGTCAAATTCATCAGA 57.549 30.769 0.00 0.00 0.00 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 2.443390 CGGGTGGGGACTCGGTAT 60.443 66.667 0.00 0.00 0.00 2.73
166 181 2.517402 AGGAGGCCTCGCTCGTAG 60.517 66.667 26.36 0.00 0.00 3.51
275 290 2.512896 GGGCGCCAAGGAGATCAT 59.487 61.111 30.85 0.00 0.00 2.45
482 525 2.692741 GGGAGGGGAAGTCCTGGG 60.693 72.222 0.00 0.00 37.25 4.45
542 585 1.901833 GGATTTGGCCAAAGTGACCAT 59.098 47.619 32.85 16.75 33.32 3.55
566 609 3.976490 CTCTACGGTGGCTCCCCCA 62.976 68.421 0.00 0.00 42.79 4.96
635 684 3.876300 GGCGAGTTGCTTGACGAT 58.124 55.556 1.51 0.00 45.43 3.73
724 773 2.484417 CGTCTACCTCGTAGGCTCCTAA 60.484 54.545 0.00 0.00 38.45 2.69
789 840 0.395586 AAACAACCAGCAGTCTGCCA 60.396 50.000 21.32 0.00 46.52 4.92
925 976 5.885449 TCATCCCAAAAACTGAACCAAAT 57.115 34.783 0.00 0.00 0.00 2.32
926 977 5.683876 TTCATCCCAAAAACTGAACCAAA 57.316 34.783 0.00 0.00 0.00 3.28
1306 1363 1.550327 TCGACAAGATCAGCCACTCT 58.450 50.000 0.00 0.00 0.00 3.24
1323 1380 3.036075 AGAGGAAAACGTAACCCTTCG 57.964 47.619 0.00 0.00 0.00 3.79
1453 1510 7.042523 GCAGGCCATCATAATTTAAATCACAAC 60.043 37.037 5.01 0.00 0.00 3.32
1520 1577 2.159462 GCTAGCTTGTTCATGAAGGTGC 60.159 50.000 8.80 12.64 33.35 5.01
1683 1742 4.696479 ACAGATCCTTCAACACAGAGTT 57.304 40.909 0.00 0.00 42.42 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.