Multiple sequence alignment - TraesCS3B01G283300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G283300 chr3B 100.000 2543 0 0 1 2543 454515651 454518193 0.000000e+00 4697
1 TraesCS3B01G283300 chr3B 96.223 1615 50 5 937 2543 804661400 804663011 0.000000e+00 2634
2 TraesCS3B01G283300 chr4B 96.037 1615 53 5 937 2543 585995276 585996887 0.000000e+00 2617
3 TraesCS3B01G283300 chr4B 95.499 1644 59 8 911 2543 534922638 534920999 0.000000e+00 2612
4 TraesCS3B01G283300 chr4B 91.753 97 8 0 871 967 502212669 502212573 4.410000e-28 135
5 TraesCS3B01G283300 chr2D 95.743 1621 54 6 937 2543 64509066 64510685 0.000000e+00 2597
6 TraesCS3B01G283300 chr7B 94.550 1688 66 7 871 2543 54520426 54518750 0.000000e+00 2584
7 TraesCS3B01G283300 chr7B 93.699 1095 38 6 881 1968 503343198 503344268 0.000000e+00 1611
8 TraesCS3B01G283300 chr7B 95.932 885 30 2 1 882 197839275 197838394 0.000000e+00 1430
9 TraesCS3B01G283300 chr7B 94.915 885 42 1 3 884 168281248 168280364 0.000000e+00 1382
10 TraesCS3B01G283300 chr7B 95.183 872 38 2 13 881 193567322 193568192 0.000000e+00 1375
11 TraesCS3B01G283300 chr7B 94.653 879 43 2 3 878 192016443 192017320 0.000000e+00 1360
12 TraesCS3B01G283300 chr7B 93.946 892 48 4 1 887 167679224 167680114 0.000000e+00 1343
13 TraesCS3B01G283300 chr5B 94.484 1686 69 9 871 2543 680909776 680908102 0.000000e+00 2577
14 TraesCS3B01G283300 chr5B 94.671 882 44 1 3 881 705993779 705992898 0.000000e+00 1365
15 TraesCS3B01G283300 chr5B 90.758 844 67 3 881 1714 548612676 548611834 0.000000e+00 1116
16 TraesCS3B01G283300 chr2B 94.413 1611 72 11 937 2538 546410656 546412257 0.000000e+00 2460
17 TraesCS3B01G283300 chr2B 95.006 881 40 2 3 880 141970719 141971598 0.000000e+00 1380
18 TraesCS3B01G283300 chr2B 92.079 101 8 0 871 971 776161686 776161786 2.640000e-30 143
19 TraesCS3B01G283300 chr2B 91.837 98 8 0 871 968 282315775 282315872 1.230000e-28 137
20 TraesCS3B01G283300 chr2B 90.099 101 10 0 871 971 767055135 767055035 5.710000e-27 132
21 TraesCS3B01G283300 chrUn 94.136 1620 78 7 937 2542 37355410 37353794 0.000000e+00 2449
22 TraesCS3B01G283300 chrUn 94.136 1620 78 7 937 2542 287430937 287429321 0.000000e+00 2449
23 TraesCS3B01G283300 chrUn 94.451 883 45 2 3 882 66325551 66326432 0.000000e+00 1356
24 TraesCS3B01G283300 chr1B 94.892 881 42 1 3 880 23285899 23285019 0.000000e+00 1375
25 TraesCS3B01G283300 chr1B 85.646 836 97 13 890 1714 55192598 55191775 0.000000e+00 857


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G283300 chr3B 454515651 454518193 2542 False 4697 4697 100.000 1 2543 1 chr3B.!!$F1 2542
1 TraesCS3B01G283300 chr3B 804661400 804663011 1611 False 2634 2634 96.223 937 2543 1 chr3B.!!$F2 1606
2 TraesCS3B01G283300 chr4B 585995276 585996887 1611 False 2617 2617 96.037 937 2543 1 chr4B.!!$F1 1606
3 TraesCS3B01G283300 chr4B 534920999 534922638 1639 True 2612 2612 95.499 911 2543 1 chr4B.!!$R2 1632
4 TraesCS3B01G283300 chr2D 64509066 64510685 1619 False 2597 2597 95.743 937 2543 1 chr2D.!!$F1 1606
5 TraesCS3B01G283300 chr7B 54518750 54520426 1676 True 2584 2584 94.550 871 2543 1 chr7B.!!$R1 1672
6 TraesCS3B01G283300 chr7B 503343198 503344268 1070 False 1611 1611 93.699 881 1968 1 chr7B.!!$F4 1087
7 TraesCS3B01G283300 chr7B 197838394 197839275 881 True 1430 1430 95.932 1 882 1 chr7B.!!$R3 881
8 TraesCS3B01G283300 chr7B 168280364 168281248 884 True 1382 1382 94.915 3 884 1 chr7B.!!$R2 881
9 TraesCS3B01G283300 chr7B 193567322 193568192 870 False 1375 1375 95.183 13 881 1 chr7B.!!$F3 868
10 TraesCS3B01G283300 chr7B 192016443 192017320 877 False 1360 1360 94.653 3 878 1 chr7B.!!$F2 875
11 TraesCS3B01G283300 chr7B 167679224 167680114 890 False 1343 1343 93.946 1 887 1 chr7B.!!$F1 886
12 TraesCS3B01G283300 chr5B 680908102 680909776 1674 True 2577 2577 94.484 871 2543 1 chr5B.!!$R2 1672
13 TraesCS3B01G283300 chr5B 705992898 705993779 881 True 1365 1365 94.671 3 881 1 chr5B.!!$R3 878
14 TraesCS3B01G283300 chr5B 548611834 548612676 842 True 1116 1116 90.758 881 1714 1 chr5B.!!$R1 833
15 TraesCS3B01G283300 chr2B 546410656 546412257 1601 False 2460 2460 94.413 937 2538 1 chr2B.!!$F3 1601
16 TraesCS3B01G283300 chr2B 141970719 141971598 879 False 1380 1380 95.006 3 880 1 chr2B.!!$F1 877
17 TraesCS3B01G283300 chrUn 37353794 37355410 1616 True 2449 2449 94.136 937 2542 1 chrUn.!!$R1 1605
18 TraesCS3B01G283300 chrUn 287429321 287430937 1616 True 2449 2449 94.136 937 2542 1 chrUn.!!$R2 1605
19 TraesCS3B01G283300 chrUn 66325551 66326432 881 False 1356 1356 94.451 3 882 1 chrUn.!!$F1 879
20 TraesCS3B01G283300 chr1B 23285019 23285899 880 True 1375 1375 94.892 3 880 1 chr1B.!!$R1 877
21 TraesCS3B01G283300 chr1B 55191775 55192598 823 True 857 857 85.646 890 1714 1 chr1B.!!$R2 824

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
29 30 0.754957 CCGGACTGAGCATCTCCTCT 60.755 60.0 0.0 0.0 34.92 3.69 F
590 591 2.424601 TCCTACCATTGTAACCGACTCG 59.575 50.0 0.0 0.0 0.00 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1086 1109 1.974957 TGAGAAACCCTCCGATCAACA 59.025 47.619 0.0 0.0 41.25 3.33 R
2522 2609 1.125270 TGTCGTGTCATGTTTCGTCG 58.875 50.000 0.0 0.0 0.00 5.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
29 30 0.754957 CCGGACTGAGCATCTCCTCT 60.755 60.000 0.00 0.0 34.92 3.69
216 217 5.065602 GCCAAGGGGTAAAACGTAAAGATAG 59.934 44.000 0.00 0.0 36.17 2.08
500 501 9.255304 GACTATGAAGATACAAGATTGAAGACC 57.745 37.037 0.00 0.0 0.00 3.85
590 591 2.424601 TCCTACCATTGTAACCGACTCG 59.575 50.000 0.00 0.0 0.00 4.18
648 649 3.071023 CGGATGGCTTTAGTCCATAGGAA 59.929 47.826 5.92 0.0 43.90 3.36
1024 1045 4.379243 CCGCAAGCTCCACCTCGT 62.379 66.667 0.00 0.0 0.00 4.18
1196 1219 1.459450 CCATTTTCGTGGTCGGGATT 58.541 50.000 0.00 0.0 37.69 3.01
1402 1426 2.020720 GCACTGACAGAGAGCTAGCTA 58.979 52.381 19.38 0.0 35.53 3.32
1705 1735 8.919661 GGAATTCAGAAACTTTTGATCAATGAC 58.080 33.333 9.40 0.0 0.00 3.06
1707 1737 9.820725 AATTCAGAAACTTTTGATCAATGACAA 57.179 25.926 9.40 0.0 0.00 3.18
2011 2081 2.280933 CCGCGTGGGTTTGTGGTA 60.281 61.111 7.26 0.0 0.00 3.25
2040 2110 1.740285 CGCTGGTAACCGCTAGGAT 59.260 57.895 0.00 0.0 41.02 3.24
2357 2438 3.380320 CACCCCCTCCGATTTTCATTAAC 59.620 47.826 0.00 0.0 0.00 2.01
2522 2609 0.663568 CGGACAGTTCACGGACTCAC 60.664 60.000 0.00 0.0 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 1.000993 AGGAGATGCTCAGTCCGGT 59.999 57.895 0.00 0.00 35.33 5.28
11 12 1.974265 TAGAGGAGATGCTCAGTCCG 58.026 55.000 4.10 0.00 35.33 4.79
457 458 2.107141 CTTGGAGTCCGGCCGATC 59.893 66.667 30.73 20.85 0.00 3.69
590 591 1.343431 GGGAGGGCTAGGGTTACACC 61.343 65.000 0.00 0.00 37.60 4.16
648 649 5.545723 AGCTAGCCTATGGTATGATTGTTCT 59.454 40.000 12.13 0.00 0.00 3.01
1086 1109 1.974957 TGAGAAACCCTCCGATCAACA 59.025 47.619 0.00 0.00 41.25 3.33
1196 1219 3.896888 ACAGATCAACCCATTGCTCAAAA 59.103 39.130 0.00 0.00 34.09 2.44
1402 1426 6.715280 TCTTCTTCAACATCCTAAGCTCAAT 58.285 36.000 0.00 0.00 0.00 2.57
1705 1735 7.268199 TCTGGAATAATTCATTAGCTGCTTG 57.732 36.000 7.79 0.29 0.00 4.01
1707 1737 5.472820 GCTCTGGAATAATTCATTAGCTGCT 59.527 40.000 7.57 7.57 0.00 4.24
2011 2081 2.089201 GTTACCAGCGCAACCCTAAAT 58.911 47.619 11.47 0.00 0.00 1.40
2040 2110 4.264253 CCATGTCAAAGTCTTGCCATCTA 58.736 43.478 0.00 0.00 28.75 1.98
2522 2609 1.125270 TGTCGTGTCATGTTTCGTCG 58.875 50.000 0.00 0.00 0.00 5.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.