Multiple sequence alignment - TraesCS3B01G249900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G249900 chr3B 100.000 2450 0 0 1 2450 398773051 398775500 0 4525
1 TraesCS3B01G249900 chr3B 92.752 2456 132 20 1 2450 409840461 409838046 0 3507
2 TraesCS3B01G249900 chr3B 91.966 2452 171 11 1 2450 565179986 565182413 0 3413
3 TraesCS3B01G249900 chr3B 90.747 2475 149 33 1 2450 453571587 453569168 0 3229
4 TraesCS3B01G249900 chr3B 91.132 2323 149 30 1 2313 81050319 81052594 0 3096
5 TraesCS3B01G249900 chr3B 88.690 2458 255 14 1 2450 120082982 120080540 0 2977
6 TraesCS3B01G249900 chr3B 89.043 2455 187 49 1 2450 195665387 195667764 0 2968
7 TraesCS3B01G249900 chr3B 86.748 2460 244 46 1 2450 331024970 331027357 0 2662
8 TraesCS3B01G249900 chr3B 86.631 2461 238 54 1 2450 533671459 533669079 0 2638
9 TraesCS3B01G249900 chr3B 88.822 1163 116 10 1 1151 376502262 376503422 0 1415
10 TraesCS3B01G249900 chrUn 98.613 2451 33 1 1 2450 59444582 59442132 0 4337
11 TraesCS3B01G249900 chrUn 90.784 2463 188 29 1 2450 79020033 79017597 0 3254
12 TraesCS3B01G249900 chr5B 94.454 2452 126 7 1 2450 316555839 316553396 0 3766
13 TraesCS3B01G249900 chr2B 93.075 2455 139 13 1 2450 550642956 550640528 0 3563
14 TraesCS3B01G249900 chr2B 91.232 2452 175 20 1 2450 762706244 762708657 0 3301
15 TraesCS3B01G249900 chr2B 92.047 1182 91 3 1 1180 386132978 386134158 0 1659
16 TraesCS3B01G249900 chr7B 91.437 2464 187 17 1 2450 476087857 476085404 0 3360
17 TraesCS3B01G249900 chr6B 87.002 2385 258 30 73 2450 371840573 371842912 0 2639


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G249900 chr3B 398773051 398775500 2449 False 4525 4525 100.000 1 2450 1 chr3B.!!$F5 2449
1 TraesCS3B01G249900 chr3B 409838046 409840461 2415 True 3507 3507 92.752 1 2450 1 chr3B.!!$R2 2449
2 TraesCS3B01G249900 chr3B 565179986 565182413 2427 False 3413 3413 91.966 1 2450 1 chr3B.!!$F6 2449
3 TraesCS3B01G249900 chr3B 453569168 453571587 2419 True 3229 3229 90.747 1 2450 1 chr3B.!!$R3 2449
4 TraesCS3B01G249900 chr3B 81050319 81052594 2275 False 3096 3096 91.132 1 2313 1 chr3B.!!$F1 2312
5 TraesCS3B01G249900 chr3B 120080540 120082982 2442 True 2977 2977 88.690 1 2450 1 chr3B.!!$R1 2449
6 TraesCS3B01G249900 chr3B 195665387 195667764 2377 False 2968 2968 89.043 1 2450 1 chr3B.!!$F2 2449
7 TraesCS3B01G249900 chr3B 331024970 331027357 2387 False 2662 2662 86.748 1 2450 1 chr3B.!!$F3 2449
8 TraesCS3B01G249900 chr3B 533669079 533671459 2380 True 2638 2638 86.631 1 2450 1 chr3B.!!$R4 2449
9 TraesCS3B01G249900 chr3B 376502262 376503422 1160 False 1415 1415 88.822 1 1151 1 chr3B.!!$F4 1150
10 TraesCS3B01G249900 chrUn 59442132 59444582 2450 True 4337 4337 98.613 1 2450 1 chrUn.!!$R1 2449
11 TraesCS3B01G249900 chrUn 79017597 79020033 2436 True 3254 3254 90.784 1 2450 1 chrUn.!!$R2 2449
12 TraesCS3B01G249900 chr5B 316553396 316555839 2443 True 3766 3766 94.454 1 2450 1 chr5B.!!$R1 2449
13 TraesCS3B01G249900 chr2B 550640528 550642956 2428 True 3563 3563 93.075 1 2450 1 chr2B.!!$R1 2449
14 TraesCS3B01G249900 chr2B 762706244 762708657 2413 False 3301 3301 91.232 1 2450 1 chr2B.!!$F2 2449
15 TraesCS3B01G249900 chr2B 386132978 386134158 1180 False 1659 1659 92.047 1 1180 1 chr2B.!!$F1 1179
16 TraesCS3B01G249900 chr7B 476085404 476087857 2453 True 3360 3360 91.437 1 2450 1 chr7B.!!$R1 2449
17 TraesCS3B01G249900 chr6B 371840573 371842912 2339 False 2639 2639 87.002 73 2450 1 chr6B.!!$F1 2377

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
433 434 2.662866 CAGGAGATGTTGCCAATGGAT 58.337 47.619 2.05 0.0 0.0 3.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1674 1718 4.941873 GTCGAAGGTAAAATTCAGTGGGAT 59.058 41.667 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
433 434 2.662866 CAGGAGATGTTGCCAATGGAT 58.337 47.619 2.05 0.0 0.00 3.41
551 561 3.969287 AGCTCACATTGCTTAGTCTCA 57.031 42.857 0.00 0.0 37.52 3.27
589 599 4.722220 CTGAAGATGATCCAATTAGGCCA 58.278 43.478 5.01 0.0 37.29 5.36
1191 1202 5.474532 TGAAACATATCATTCCCATGCTAGC 59.525 40.000 8.10 8.1 0.00 3.42
1674 1718 7.517614 TGCTTGTGTCATTTCTTAAATACCA 57.482 32.000 0.00 0.0 0.00 3.25
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
624 634 6.213600 TCCTTACTTCATCCACTAGCTCTTTT 59.786 38.462 0.00 0.0 0.00 2.27
1627 1671 6.926272 GCAACCCAAATAACAGTTGATTACAA 59.074 34.615 5.95 0.0 41.65 2.41
1674 1718 4.941873 GTCGAAGGTAAAATTCAGTGGGAT 59.058 41.667 0.00 0.0 0.00 3.85
2158 2206 5.773091 TCCTGAGAACATGGTATACACCTA 58.227 41.667 5.01 0.0 45.98 3.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.