Multiple sequence alignment - TraesCS3B01G245700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G245700 chr3B 100.000 2480 0 0 1 2480 389719855 389722334 0 4580
1 TraesCS3B01G245700 chr3B 98.236 1701 28 2 1 1699 361795826 361797526 0 2974
2 TraesCS3B01G245700 chr3B 94.094 982 37 14 1518 2480 361797400 361798379 0 1472
3 TraesCS3B01G245700 chr2B 98.060 1701 31 2 1 1699 728070275 728068575 0 2957
4 TraesCS3B01G245700 chr2B 93.279 982 45 14 1518 2480 728068701 728067722 0 1428
5 TraesCS3B01G245700 chr4D 97.709 1702 35 4 1 1699 393458503 393460203 0 2924
6 TraesCS3B01G245700 chr4D 93.177 982 46 14 1518 2480 393460077 393461056 0 1423
7 TraesCS3B01G245700 chr6B 97.648 1701 35 3 1 1699 587366784 587365087 0 2915
8 TraesCS3B01G245700 chr6B 92.668 982 50 15 1518 2480 587365213 587364235 0 1395
9 TraesCS3B01G245700 chr3D 97.531 1701 37 4 1 1699 359527471 359525774 0 2904
10 TraesCS3B01G245700 chr3D 92.879 983 47 16 1518 2480 359525900 359524921 0 1406
11 TraesCS3B01G245700 chr1D 97.472 1701 40 3 1 1699 251020559 251022258 0 2900
12 TraesCS3B01G245700 chr1D 92.057 982 57 14 1518 2480 251022132 251023111 0 1362
13 TraesCS3B01G245700 chr5D 97.121 1702 46 3 1 1699 557793948 557795649 0 2868
14 TraesCS3B01G245700 chr5D 98.107 951 16 2 751 1699 565809433 565810383 0 1655
15 TraesCS3B01G245700 chr5D 92.879 983 46 17 1518 2480 557795578 557796556 0 1406
16 TraesCS3B01G245700 chr5D 92.472 983 51 16 1518 2480 565810257 565811236 0 1384
17 TraesCS3B01G245700 chr2D 96.945 1702 49 3 1 1699 621997763 621999464 0 2852
18 TraesCS3B01G245700 chr2D 92.981 983 46 16 1518 2480 621999393 622000372 0 1411
19 TraesCS3B01G245700 chr6A 94.734 1709 69 14 1 1699 583326530 583328227 0 2638


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G245700 chr3B 389719855 389722334 2479 False 4580.0 4580 100.0000 1 2480 1 chr3B.!!$F1 2479
1 TraesCS3B01G245700 chr3B 361795826 361798379 2553 False 2223.0 2974 96.1650 1 2480 2 chr3B.!!$F2 2479
2 TraesCS3B01G245700 chr2B 728067722 728070275 2553 True 2192.5 2957 95.6695 1 2480 2 chr2B.!!$R1 2479
3 TraesCS3B01G245700 chr4D 393458503 393461056 2553 False 2173.5 2924 95.4430 1 2480 2 chr4D.!!$F1 2479
4 TraesCS3B01G245700 chr6B 587364235 587366784 2549 True 2155.0 2915 95.1580 1 2480 2 chr6B.!!$R1 2479
5 TraesCS3B01G245700 chr3D 359524921 359527471 2550 True 2155.0 2904 95.2050 1 2480 2 chr3D.!!$R1 2479
6 TraesCS3B01G245700 chr1D 251020559 251023111 2552 False 2131.0 2900 94.7645 1 2480 2 chr1D.!!$F1 2479
7 TraesCS3B01G245700 chr5D 557793948 557796556 2608 False 2137.0 2868 95.0000 1 2480 2 chr5D.!!$F1 2479
8 TraesCS3B01G245700 chr5D 565809433 565811236 1803 False 1519.5 1655 95.2895 751 2480 2 chr5D.!!$F2 1729
9 TraesCS3B01G245700 chr2D 621997763 622000372 2609 False 2131.5 2852 94.9630 1 2480 2 chr2D.!!$F1 2479
10 TraesCS3B01G245700 chr6A 583326530 583328227 1697 False 2638.0 2638 94.7340 1 1699 1 chr6A.!!$F1 1698

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
283 285 2.177531 GGCATGAGCAGCAACGTG 59.822 61.111 0.0 1.19 44.61 4.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1802 1998 3.010696 TGCAACCATCCCATACCACTTAA 59.989 43.478 0.0 0.0 0.0 1.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 33 3.274959 TCCTCCTCCCTCCAATTTCTCTA 59.725 47.826 0.00 0.00 0.00 2.43
182 183 2.199117 CTGATGCCAGCAAGCCATT 58.801 52.632 0.00 0.00 33.07 3.16
224 226 2.659016 CTGCGAGCCAGGAGTCAA 59.341 61.111 0.00 0.00 37.93 3.18
283 285 2.177531 GGCATGAGCAGCAACGTG 59.822 61.111 0.00 1.19 44.61 4.49
1148 1160 4.568592 GGAGGATGAGGTTCATGAGGTTTT 60.569 45.833 0.00 0.00 37.20 2.43
1454 1468 5.198602 AGGTTCAATTGGCTTAAGAGGAT 57.801 39.130 6.67 0.00 0.00 3.24
1685 1809 7.306632 GGAGTGAACTATTGTATCGTTGTATGC 60.307 40.741 0.00 0.00 0.00 3.14
1699 1823 5.061684 TCGTTGTATGCGACTTGAACTATTG 59.938 40.000 0.00 0.00 33.09 1.90
1700 1824 5.163992 CGTTGTATGCGACTTGAACTATTGT 60.164 40.000 0.00 0.00 0.00 2.71
1701 1825 6.034150 CGTTGTATGCGACTTGAACTATTGTA 59.966 38.462 0.00 0.00 0.00 2.41
1702 1826 7.253983 CGTTGTATGCGACTTGAACTATTGTAT 60.254 37.037 0.00 0.00 0.00 2.29
1703 1827 7.694388 TGTATGCGACTTGAACTATTGTATC 57.306 36.000 0.00 0.00 0.00 2.24
1704 1828 5.890110 ATGCGACTTGAACTATTGTATCG 57.110 39.130 0.00 0.00 0.00 2.92
1706 1830 5.165676 TGCGACTTGAACTATTGTATCGTT 58.834 37.500 0.00 0.00 0.00 3.85
1970 2166 5.769662 ACCTATGAAAGTCTTGCAATGTTCA 59.230 36.000 0.00 8.03 0.00 3.18
2262 2458 6.909158 AGATATATTGGGAAATCGGGGATACT 59.091 38.462 0.00 0.00 0.00 2.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 33 1.381867 TTTGGATGGTGGAGATGGGT 58.618 50.000 0.00 0.00 0.00 4.51
145 146 2.586245 CCAGAAGAGGCGGATGCA 59.414 61.111 0.00 0.00 45.35 3.96
1454 1468 9.438228 TTCAATTTCCATACTTGTCGTTGTATA 57.562 29.630 0.00 0.00 0.00 1.47
1685 1809 6.627690 ACAACGATACAATAGTTCAAGTCG 57.372 37.500 0.00 0.00 0.00 4.18
1699 1823 7.962918 AGATTGCAAAACTTCATACAACGATAC 59.037 33.333 1.71 0.00 0.00 2.24
1700 1824 8.039603 AGATTGCAAAACTTCATACAACGATA 57.960 30.769 1.71 0.00 0.00 2.92
1701 1825 6.913170 AGATTGCAAAACTTCATACAACGAT 58.087 32.000 1.71 0.00 0.00 3.73
1702 1826 6.312399 AGATTGCAAAACTTCATACAACGA 57.688 33.333 1.71 0.00 0.00 3.85
1703 1827 6.417635 ACAAGATTGCAAAACTTCATACAACG 59.582 34.615 15.90 7.94 36.76 4.10
1704 1828 7.698836 ACAAGATTGCAAAACTTCATACAAC 57.301 32.000 15.90 0.00 36.76 3.32
1706 1830 7.648908 CAGAACAAGATTGCAAAACTTCATACA 59.351 33.333 15.90 0.00 36.76 2.29
1802 1998 3.010696 TGCAACCATCCCATACCACTTAA 59.989 43.478 0.00 0.00 0.00 1.85
1970 2166 3.324268 TCATTGCCACCACAAATGAACAT 59.676 39.130 0.00 0.00 32.27 2.71
2262 2458 6.817641 ACAAATTGCAAGAACATTTTGAGTCA 59.182 30.769 21.60 0.00 40.66 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.