Multiple sequence alignment - TraesCS3B01G238200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G238200 chr3B 100.000 2498 0 0 1 2498 373468509 373466012 0 4614
1 TraesCS3B01G238200 chr3B 97.114 1698 36 6 1 1689 703633214 703631521 0 2852
2 TraesCS3B01G238200 chr3B 95.535 1702 58 6 1 1689 598440105 598441801 0 2706
3 TraesCS3B01G238200 chr3B 94.811 1696 52 9 1 1685 623102013 623100343 0 2612
4 TraesCS3B01G238200 chr3B 97.414 812 19 2 1687 2498 703631475 703630666 0 1382
5 TraesCS3B01G238200 chrUn 96.936 1697 40 5 1 1689 130604387 130606079 0 2835
6 TraesCS3B01G238200 chrUn 98.160 815 13 2 1684 2498 130606122 130606934 0 1421
7 TraesCS3B01G238200 chr6B 96.763 1699 39 9 1 1689 457484072 457482380 0 2819
8 TraesCS3B01G238200 chr6B 98.153 812 12 3 1687 2498 457482334 457481526 0 1413
9 TraesCS3B01G238200 chr6B 97.301 815 20 2 1684 2498 456647719 456648531 0 1382
10 TraesCS3B01G238200 chr4B 96.641 1697 43 6 1 1686 178220846 178222539 0 2806
11 TraesCS3B01G238200 chr4B 97.669 815 16 3 1684 2498 178222585 178223396 0 1397
12 TraesCS3B01G238200 chr7B 96.292 1699 47 7 1 1689 39504587 39502895 0 2774
13 TraesCS3B01G238200 chr7B 96.320 1685 56 5 1 1685 675672014 675673692 0 2763
14 TraesCS3B01G238200 chr7B 96.108 1696 53 7 1 1685 641772864 641774557 0 2754
15 TraesCS3B01G238200 chr7B 95.165 1696 45 13 1 1685 484220111 484218442 0 2643
16 TraesCS3B01G238200 chr7B 98.155 813 14 1 1687 2498 39502849 39502037 0 1417
17 TraesCS3B01G238200 chr2B 96.294 1700 46 8 1 1689 192841802 192843495 0 2774
18 TraesCS3B01G238200 chr2B 97.552 817 17 2 1684 2498 734311728 734312543 0 1395
19 TraesCS3B01G238200 chr2B 96.940 817 22 2 1684 2498 192843538 192844353 0 1367
20 TraesCS3B01G238200 chr3A 95.050 1717 53 13 1 1689 679383993 679382281 0 2671
21 TraesCS3B01G238200 chr2A 94.596 1721 57 16 1 1689 538373745 538372029 0 2630
22 TraesCS3B01G238200 chr5B 98.276 812 13 1 1687 2498 448383643 448382833 0 1421


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G238200 chr3B 373466012 373468509 2497 True 4614.0 4614 100.0000 1 2498 1 chr3B.!!$R1 2497
1 TraesCS3B01G238200 chr3B 598440105 598441801 1696 False 2706.0 2706 95.5350 1 1689 1 chr3B.!!$F1 1688
2 TraesCS3B01G238200 chr3B 623100343 623102013 1670 True 2612.0 2612 94.8110 1 1685 1 chr3B.!!$R2 1684
3 TraesCS3B01G238200 chr3B 703630666 703633214 2548 True 2117.0 2852 97.2640 1 2498 2 chr3B.!!$R3 2497
4 TraesCS3B01G238200 chrUn 130604387 130606934 2547 False 2128.0 2835 97.5480 1 2498 2 chrUn.!!$F1 2497
5 TraesCS3B01G238200 chr6B 457481526 457484072 2546 True 2116.0 2819 97.4580 1 2498 2 chr6B.!!$R1 2497
6 TraesCS3B01G238200 chr6B 456647719 456648531 812 False 1382.0 1382 97.3010 1684 2498 1 chr6B.!!$F1 814
7 TraesCS3B01G238200 chr4B 178220846 178223396 2550 False 2101.5 2806 97.1550 1 2498 2 chr4B.!!$F1 2497
8 TraesCS3B01G238200 chr7B 675672014 675673692 1678 False 2763.0 2763 96.3200 1 1685 1 chr7B.!!$F2 1684
9 TraesCS3B01G238200 chr7B 641772864 641774557 1693 False 2754.0 2754 96.1080 1 1685 1 chr7B.!!$F1 1684
10 TraesCS3B01G238200 chr7B 484218442 484220111 1669 True 2643.0 2643 95.1650 1 1685 1 chr7B.!!$R1 1684
11 TraesCS3B01G238200 chr7B 39502037 39504587 2550 True 2095.5 2774 97.2235 1 2498 2 chr7B.!!$R2 2497
12 TraesCS3B01G238200 chr2B 192841802 192844353 2551 False 2070.5 2774 96.6170 1 2498 2 chr2B.!!$F2 2497
13 TraesCS3B01G238200 chr2B 734311728 734312543 815 False 1395.0 1395 97.5520 1684 2498 1 chr2B.!!$F1 814
14 TraesCS3B01G238200 chr3A 679382281 679383993 1712 True 2671.0 2671 95.0500 1 1689 1 chr3A.!!$R1 1688
15 TraesCS3B01G238200 chr2A 538372029 538373745 1716 True 2630.0 2630 94.5960 1 1689 1 chr2A.!!$R1 1688
16 TraesCS3B01G238200 chr5B 448382833 448383643 810 True 1421.0 1421 98.2760 1687 2498 1 chr5B.!!$R1 811

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
871 909 2.678471 TGAGCAGATCGAGCAATTCA 57.322 45.0 2.38 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1779 1883 1.451387 CTTTGGGCCCGCGAACTAT 60.451 57.895 19.37 0.0 0.0 2.12 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
229 240 6.148480 GTGATAGCTCATTTGTGTGAAGACTT 59.852 38.462 0.00 0.00 32.98 3.01
230 241 6.712095 TGATAGCTCATTTGTGTGAAGACTTT 59.288 34.615 0.00 0.00 0.00 2.66
308 322 7.956692 CACATATGACAGCTATGTGCGCAAC 62.957 48.000 14.00 7.43 45.45 4.17
852 890 3.087031 CCATCTGACAGACAAAGGCATT 58.913 45.455 7.47 0.00 0.00 3.56
871 909 2.678471 TGAGCAGATCGAGCAATTCA 57.322 45.000 2.38 0.00 0.00 2.57
965 1003 2.680352 GACCTCCTCGTCAGCCCA 60.680 66.667 0.00 0.00 32.74 5.36
972 1010 2.915659 TCGTCAGCCCACCGTTCT 60.916 61.111 0.00 0.00 0.00 3.01
1005 1043 3.517500 TGTATGGTCTAGTGCCAATGACA 59.482 43.478 11.60 12.30 39.72 3.58
1270 1308 0.750911 CATCCAGAGGCTTCAAGGGC 60.751 60.000 0.00 0.00 0.00 5.19
1305 1343 1.227383 GAGGGGGAATGCAATCCGT 59.773 57.895 14.66 1.70 40.62 4.69
1708 1810 4.392940 GAGCAGCACAAGGGATATACATT 58.607 43.478 0.00 0.00 0.00 2.71
1713 1815 6.293626 GCAGCACAAGGGATATACATTAAGTG 60.294 42.308 0.00 0.00 0.00 3.16
1760 1862 3.996150 ACTTTTGTCCTCGAGTTCGTA 57.004 42.857 12.31 0.00 40.80 3.43
2224 2330 9.905713 TTTTAGAAGGCATCTATAAACACATCT 57.094 29.630 0.00 0.00 40.32 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
728 766 2.643655 CATGTGGTGGTCATGTGCA 58.356 52.632 0.00 0.00 38.17 4.57
852 890 2.678471 TGAATTGCTCGATCTGCTCA 57.322 45.000 8.62 2.72 0.00 4.26
871 909 5.504853 GAGAAGATGGGGAAAGAAACAGAT 58.495 41.667 0.00 0.00 0.00 2.90
972 1010 1.947597 GACCATACACCGGCCACGTA 61.948 60.000 0.00 0.21 38.78 3.57
1270 1308 3.204827 CGAATCCAGCAAGCCCGG 61.205 66.667 0.00 0.00 0.00 5.73
1305 1343 0.256752 CATGGGGCAGATTGGACTCA 59.743 55.000 0.00 0.00 0.00 3.41
1366 1419 6.055588 TCTTCTTCAATTCCGTCTTCAGTTT 58.944 36.000 0.00 0.00 0.00 2.66
1577 1631 4.098501 ACTGCATACATTCAGAGATCGACA 59.901 41.667 0.00 0.00 34.57 4.35
1708 1810 4.580580 TGCGAGAGAGAAGATATGCACTTA 59.419 41.667 0.00 0.00 0.00 2.24
1713 1815 3.641437 AGTGCGAGAGAGAAGATATGC 57.359 47.619 0.00 0.00 0.00 3.14
1779 1883 1.451387 CTTTGGGCCCGCGAACTAT 60.451 57.895 19.37 0.00 0.00 2.12
1832 1937 8.533569 AAGAACAAAGAAATCCTTCCTAAACA 57.466 30.769 0.00 0.00 33.02 2.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.