Multiple sequence alignment - TraesCS3B01G220600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G220600 chr3B 100.000 4858 0 0 1 4858 270886021 270890878 0.000000e+00 8972.0
1 TraesCS3B01G220600 chr3B 89.925 268 23 4 459 723 367490682 367490948 4.660000e-90 342.0
2 TraesCS3B01G220600 chr3A 94.156 3525 109 36 1234 4676 241927045 241923536 0.000000e+00 5278.0
3 TraesCS3B01G220600 chr3A 95.793 523 21 1 726 1247 241927585 241927063 0.000000e+00 843.0
4 TraesCS3B01G220600 chr3A 82.840 169 20 7 288 453 241927784 241927622 5.070000e-30 143.0
5 TraesCS3B01G220600 chr3A 79.545 88 13 4 4320 4404 12842332 12842417 1.890000e-04 58.4
6 TraesCS3B01G220600 chr3D 95.780 3199 84 21 1234 4404 188354768 188357943 0.000000e+00 5112.0
7 TraesCS3B01G220600 chr3D 94.877 527 22 4 725 1247 188354225 188354750 0.000000e+00 819.0
8 TraesCS3B01G220600 chr3D 94.158 291 16 1 1 291 188351938 188352227 4.460000e-120 442.0
9 TraesCS3B01G220600 chr3D 90.189 265 21 5 461 722 18703267 18703005 1.670000e-89 340.0
10 TraesCS3B01G220600 chr3D 93.000 200 12 2 1 200 197105072 197104875 1.710000e-74 291.0
11 TraesCS3B01G220600 chr3D 93.264 193 12 1 1 193 91634352 91634543 2.860000e-72 283.0
12 TraesCS3B01G220600 chr3D 92.347 196 14 1 1 196 200320148 200319954 1.330000e-70 278.0
13 TraesCS3B01G220600 chr3D 92.746 193 13 1 1 193 326280320 326280129 1.330000e-70 278.0
14 TraesCS3B01G220600 chr3D 92.517 147 9 2 288 433 188352316 188352461 4.930000e-50 209.0
15 TraesCS3B01G220600 chr3D 91.228 57 5 0 4684 4740 543933596 543933652 1.450000e-10 78.7
16 TraesCS3B01G220600 chr7B 91.045 268 17 7 459 721 663837898 663837633 5.980000e-94 355.0
17 TraesCS3B01G220600 chr7B 90.226 266 20 6 459 720 387641617 387641880 4.660000e-90 342.0
18 TraesCS3B01G220600 chr7B 96.429 84 3 0 4775 4858 536260640 536260557 6.560000e-29 139.0
19 TraesCS3B01G220600 chr2B 90.146 274 22 5 461 731 627873457 627873728 7.740000e-93 351.0
20 TraesCS3B01G220600 chr5B 90.566 265 19 6 459 718 618270122 618269859 3.600000e-91 346.0
21 TraesCS3B01G220600 chr5B 98.810 84 0 1 4773 4856 13718698 13718616 1.090000e-31 148.0
22 TraesCS3B01G220600 chr1D 90.602 266 18 7 459 720 454151604 454151866 3.600000e-91 346.0
23 TraesCS3B01G220600 chr1D 98.701 77 1 0 4782 4858 192809918 192809994 2.360000e-28 137.0
24 TraesCS3B01G220600 chr1D 97.468 79 2 0 4780 4858 47310446 47310368 8.480000e-28 135.0
25 TraesCS3B01G220600 chr1D 87.302 63 8 0 4673 4735 297389856 297389794 6.740000e-09 73.1
26 TraesCS3B01G220600 chr1D 92.000 50 4 0 4684 4733 174151220 174151171 2.430000e-08 71.3
27 TraesCS3B01G220600 chr1D 88.525 61 4 2 4673 4730 201373414 201373354 2.430000e-08 71.3
28 TraesCS3B01G220600 chr1D 88.710 62 2 5 4673 4730 398734112 398734052 2.430000e-08 71.3
29 TraesCS3B01G220600 chr5A 90.262 267 21 5 459 721 64980775 64980510 1.290000e-90 344.0
30 TraesCS3B01G220600 chr5A 98.750 80 1 0 4779 4858 512022297 512022376 5.070000e-30 143.0
31 TraesCS3B01G220600 chr5A 97.590 83 2 0 4776 4858 546827616 546827534 5.070000e-30 143.0
32 TraesCS3B01G220600 chr2D 90.189 265 22 4 459 720 618294514 618294777 4.660000e-90 342.0
33 TraesCS3B01G220600 chr2D 92.746 193 13 1 1 193 239791651 239791460 1.330000e-70 278.0
34 TraesCS3B01G220600 chr2D 92.347 196 14 1 1 196 289110675 289110481 1.330000e-70 278.0
35 TraesCS3B01G220600 chr2D 90.164 61 3 2 4673 4730 216720369 216720429 5.210000e-10 76.8
36 TraesCS3B01G220600 chr2D 92.453 53 4 0 4685 4737 613097062 613097114 5.210000e-10 76.8
37 TraesCS3B01G220600 chr2D 88.710 62 4 2 4673 4731 262479702 262479763 6.740000e-09 73.1
38 TraesCS3B01G220600 chr2D 100.000 31 0 0 4374 4404 560858941 560858911 1.890000e-04 58.4
39 TraesCS3B01G220600 chr6A 92.857 196 13 1 1 196 168146538 168146732 2.860000e-72 283.0
40 TraesCS3B01G220600 chr6A 90.164 61 4 1 4672 4730 614385619 614385559 1.450000e-10 78.7
41 TraesCS3B01G220600 chr6A 91.071 56 3 2 4684 4738 12423624 12423678 1.880000e-09 75.0
42 TraesCS3B01G220600 chr6A 100.000 31 0 0 4374 4404 81122104 81122074 1.890000e-04 58.4
43 TraesCS3B01G220600 chr4D 91.878 197 15 1 1 197 293495630 293495435 1.720000e-69 274.0
44 TraesCS3B01G220600 chr4D 96.429 84 2 1 4776 4858 164649548 164649465 2.360000e-28 137.0
45 TraesCS3B01G220600 chr4D 96.000 75 3 0 4782 4856 207559559 207559485 6.600000e-24 122.0
46 TraesCS3B01G220600 chr4D 88.710 62 6 1 4670 4730 509129526 509129587 1.880000e-09 75.0
47 TraesCS3B01G220600 chr4D 88.525 61 4 2 4673 4730 363958061 363958121 2.430000e-08 71.3
48 TraesCS3B01G220600 chr4D 87.097 62 5 2 4673 4731 89229961 89230022 3.140000e-07 67.6
49 TraesCS3B01G220600 chr7D 98.750 80 1 0 4779 4858 264138458 264138537 5.070000e-30 143.0
50 TraesCS3B01G220600 chr7D 96.552 87 2 1 4772 4858 542092362 542092277 5.070000e-30 143.0
51 TraesCS3B01G220600 chr7D 97.531 81 2 0 4778 4858 2524326 2524406 6.560000e-29 139.0
52 TraesCS3B01G220600 chr7D 98.718 78 1 0 4781 4858 234804179 234804102 6.560000e-29 139.0
53 TraesCS3B01G220600 chr7D 91.379 58 3 2 4684 4740 416240151 416240207 1.450000e-10 78.7
54 TraesCS3B01G220600 chr7D 94.118 51 2 1 4684 4733 7471619 7471669 5.210000e-10 76.8
55 TraesCS3B01G220600 chr7D 89.474 57 6 0 4684 4740 27819518 27819574 6.740000e-09 73.1
56 TraesCS3B01G220600 chr7D 85.915 71 7 3 4664 4731 220975715 220975785 6.740000e-09 73.1
57 TraesCS3B01G220600 chr4B 98.750 80 1 0 4779 4858 50445591 50445512 5.070000e-30 143.0
58 TraesCS3B01G220600 chr4B 96.429 84 3 0 4775 4858 140924647 140924564 6.560000e-29 139.0
59 TraesCS3B01G220600 chr2A 96.512 86 2 1 4773 4858 98882824 98882740 1.820000e-29 141.0
60 TraesCS3B01G220600 chr2A 91.379 58 5 0 4684 4741 596428970 596429027 4.030000e-11 80.5
61 TraesCS3B01G220600 chr2A 88.889 63 5 1 4673 4735 352991983 352992043 5.210000e-10 76.8
62 TraesCS3B01G220600 chr2A 79.439 107 18 2 4300 4404 42481301 42481197 6.740000e-09 73.1
63 TraesCS3B01G220600 chr2A 79.630 108 17 3 4300 4404 735377899 735378004 6.740000e-09 73.1
64 TraesCS3B01G220600 chrUn 98.701 77 1 0 4782 4858 37289250 37289174 2.360000e-28 137.0
65 TraesCS3B01G220600 chrUn 98.701 77 1 0 4782 4858 37292426 37292350 2.360000e-28 137.0
66 TraesCS3B01G220600 chrUn 97.531 81 1 1 4779 4858 279936304 279936224 2.360000e-28 137.0
67 TraesCS3B01G220600 chrUn 97.531 81 1 1 4779 4858 395541691 395541611 2.360000e-28 137.0
68 TraesCS3B01G220600 chrUn 96.250 80 3 0 4779 4858 278447615 278447694 1.100000e-26 132.0
69 TraesCS3B01G220600 chrUn 96.250 80 3 0 4779 4858 281845689 281845768 1.100000e-26 132.0
70 TraesCS3B01G220600 chrUn 97.403 77 2 0 4782 4858 289138431 289138355 1.100000e-26 132.0
71 TraesCS3B01G220600 chrUn 97.403 77 2 0 4782 4858 332242460 332242536 1.100000e-26 132.0
72 TraesCS3B01G220600 chrUn 95.122 82 4 0 4777 4858 42362359 42362440 3.950000e-26 130.0
73 TraesCS3B01G220600 chrUn 93.023 86 6 0 4773 4858 17014230 17014145 5.100000e-25 126.0
74 TraesCS3B01G220600 chrUn 93.976 83 5 0 4771 4853 40599746 40599828 5.100000e-25 126.0
75 TraesCS3B01G220600 chrUn 91.071 56 3 2 4684 4738 319987257 319987311 1.880000e-09 75.0
76 TraesCS3B01G220600 chrUn 92.308 52 2 2 4684 4734 84099583 84099533 6.740000e-09 73.1
77 TraesCS3B01G220600 chrUn 93.617 47 3 0 4684 4730 1181972 1181926 2.430000e-08 71.3
78 TraesCS3B01G220600 chrUn 89.091 55 6 0 4684 4738 37289211 37289157 8.720000e-08 69.4
79 TraesCS3B01G220600 chrUn 89.091 55 6 0 4684 4738 37292387 37292333 8.720000e-08 69.4
80 TraesCS3B01G220600 chrUn 91.667 48 4 0 4684 4731 35713295 35713342 3.140000e-07 67.6
81 TraesCS3B01G220600 chrUn 91.837 49 2 2 4684 4731 48472348 48472395 3.140000e-07 67.6
82 TraesCS3B01G220600 chrUn 91.837 49 2 2 4684 4731 235114449 235114496 3.140000e-07 67.6
83 TraesCS3B01G220600 chrUn 91.667 48 4 0 4684 4731 305213178 305213131 3.140000e-07 67.6
84 TraesCS3B01G220600 chrUn 91.667 48 4 0 4684 4731 320245644 320245691 3.140000e-07 67.6
85 TraesCS3B01G220600 chr6D 98.701 77 1 0 4782 4858 350223147 350223071 2.360000e-28 137.0
86 TraesCS3B01G220600 chr6D 93.182 88 4 2 4773 4858 155146769 155146856 1.420000e-25 128.0
87 TraesCS3B01G220600 chr6D 94.118 85 4 1 4774 4858 417684758 417684841 1.420000e-25 128.0
88 TraesCS3B01G220600 chr6D 89.831 59 6 0 4684 4742 372879485 372879543 5.210000e-10 76.8
89 TraesCS3B01G220600 chr6D 88.889 63 5 2 4684 4746 377870859 377870919 5.210000e-10 76.8
90 TraesCS3B01G220600 chr6D 89.091 55 4 2 4684 4736 160314831 160314777 3.140000e-07 67.6
91 TraesCS3B01G220600 chr6D 91.667 48 4 0 4684 4731 411828843 411828890 3.140000e-07 67.6
92 TraesCS3B01G220600 chr6D 86.885 61 5 2 4673 4730 135152492 135152432 1.130000e-06 65.8
93 TraesCS3B01G220600 chr6B 95.402 87 3 1 4772 4858 145574143 145574228 2.360000e-28 137.0
94 TraesCS3B01G220600 chr6B 84.416 77 10 2 4684 4758 609097579 609097655 1.880000e-09 75.0
95 TraesCS3B01G220600 chr5D 98.701 77 1 0 4782 4858 491871671 491871595 2.360000e-28 137.0
96 TraesCS3B01G220600 chr5D 94.318 88 4 1 4771 4858 218760937 218761023 3.050000e-27 134.0
97 TraesCS3B01G220600 chr5D 88.525 61 4 2 4673 4730 340640339 340640279 2.430000e-08 71.3
98 TraesCS3B01G220600 chr5D 88.333 60 6 1 4684 4742 547431589 547431530 2.430000e-08 71.3
99 TraesCS3B01G220600 chr1B 96.429 84 2 1 4775 4858 149606575 149606493 2.360000e-28 137.0
100 TraesCS3B01G220600 chr4A 82.222 90 9 5 4319 4404 151317941 151317855 2.430000e-08 71.3
101 TraesCS3B01G220600 chr7A 100.000 31 0 0 4374 4404 115794910 115794880 1.890000e-04 58.4
102 TraesCS3B01G220600 chr7A 100.000 31 0 0 4374 4404 487261804 487261774 1.890000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G220600 chr3B 270886021 270890878 4857 False 8972.0 8972 100.000000 1 4858 1 chr3B.!!$F1 4857
1 TraesCS3B01G220600 chr3A 241923536 241927784 4248 True 2088.0 5278 90.929667 288 4676 3 chr3A.!!$R1 4388
2 TraesCS3B01G220600 chr3D 188351938 188357943 6005 False 1645.5 5112 94.333000 1 4404 4 chr3D.!!$F3 4403

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
495 2305 0.034186 TTCAAATCCTGGGCTCGCAT 60.034 50.000 0.00 0.00 0.00 4.73 F
496 2306 0.034186 TCAAATCCTGGGCTCGCATT 60.034 50.000 0.00 0.00 0.00 3.56 F
648 2458 0.101219 TCATCGAGATGAGGTGTGCG 59.899 55.000 11.37 0.00 42.42 5.34 F
649 2459 0.179127 CATCGAGATGAGGTGTGCGT 60.179 55.000 7.26 0.00 41.20 5.24 F
706 2516 0.319555 TGAGCGCTTGTGTCTGTACC 60.320 55.000 13.26 0.00 0.00 3.34 F
710 2520 0.596600 CGCTTGTGTCTGTACCGTGT 60.597 55.000 0.00 0.00 0.00 4.49 F
854 2665 0.620700 TAGGTTTCCCTCTCCCAGCC 60.621 60.000 0.00 0.00 41.45 4.85 F
1679 3532 1.461127 GCAAGCCTTGACGTACTTCTG 59.539 52.381 9.04 0.00 0.00 3.02 F
3110 4970 1.094785 ACATATTTGCTGGTCACCGC 58.905 50.000 3.94 3.94 0.00 5.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1524 3377 0.610174 TAGTCCTGAGCAAGGCAGTG 59.390 55.000 0.57 0.00 46.92 3.66 R
1721 3574 0.877071 AGCAACACGATTTCTGGCAG 59.123 50.000 8.58 8.58 0.00 4.85 R
1823 3676 0.950836 TGTCACCAGAATTTGCACCG 59.049 50.000 0.00 0.00 0.00 4.94 R
1983 3836 1.064017 TGGCTCCTTGTCAGGTTTTGT 60.064 47.619 0.00 0.00 41.69 2.83 R
2592 4452 2.350522 CAGGAGCTGCGTAAAAGTGAT 58.649 47.619 0.00 0.00 0.00 3.06 R
2645 4505 3.448686 CGAAGCATAATCACGTTCTCCT 58.551 45.455 0.00 0.00 0.00 3.69 R
2927 4787 5.602145 TGGTTTCACATTCTCCTTTTCCATT 59.398 36.000 0.00 0.00 0.00 3.16 R
3716 5576 0.167470 CAGGAGTCTTTGCATGCACG 59.833 55.000 22.58 14.84 0.00 5.34 R
4751 6697 0.324614 GGAATTTTGCCTTGGGGGTG 59.675 55.000 0.00 0.00 37.43 4.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.