Multiple sequence alignment - TraesCS3B01G189600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G189600 chr3B 100.000 2528 0 0 1 2528 201635804 201633277 0 4669
1 TraesCS3B01G189600 chr7B 98.855 2533 24 4 1 2528 743066304 743068836 0 4512
2 TraesCS3B01G189600 chr7A 98.774 2529 29 2 1 2528 120828849 120826322 0 4497
3 TraesCS3B01G189600 chr7A 98.618 2532 30 5 1 2528 671960569 671958039 0 4477
4 TraesCS3B01G189600 chr2A 98.737 2533 27 3 1 2528 735172798 735175330 0 4495
5 TraesCS3B01G189600 chr5A 98.659 2535 27 5 1 2528 16623276 16620742 0 4486
6 TraesCS3B01G189600 chr2D 98.617 2531 32 2 1 2528 635037259 635039789 0 4477
7 TraesCS3B01G189600 chr5B 98.498 2530 34 3 1 2527 713046212 713043684 0 4458
8 TraesCS3B01G189600 chr3D 98.380 2531 38 3 1 2528 202611945 202614475 0 4444


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G189600 chr3B 201633277 201635804 2527 True 4669 4669 100.000 1 2528 1 chr3B.!!$R1 2527
1 TraesCS3B01G189600 chr7B 743066304 743068836 2532 False 4512 4512 98.855 1 2528 1 chr7B.!!$F1 2527
2 TraesCS3B01G189600 chr7A 120826322 120828849 2527 True 4497 4497 98.774 1 2528 1 chr7A.!!$R1 2527
3 TraesCS3B01G189600 chr7A 671958039 671960569 2530 True 4477 4477 98.618 1 2528 1 chr7A.!!$R2 2527
4 TraesCS3B01G189600 chr2A 735172798 735175330 2532 False 4495 4495 98.737 1 2528 1 chr2A.!!$F1 2527
5 TraesCS3B01G189600 chr5A 16620742 16623276 2534 True 4486 4486 98.659 1 2528 1 chr5A.!!$R1 2527
6 TraesCS3B01G189600 chr2D 635037259 635039789 2530 False 4477 4477 98.617 1 2528 1 chr2D.!!$F1 2527
7 TraesCS3B01G189600 chr5B 713043684 713046212 2528 True 4458 4458 98.498 1 2527 1 chr5B.!!$R1 2526
8 TraesCS3B01G189600 chr3D 202611945 202614475 2530 False 4444 4444 98.380 1 2528 1 chr3D.!!$F1 2527

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
105 106 1.265905 GTAGGTCGGCAGTTTGGTTTG 59.734 52.381 0.0 0.0 0.0 2.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1695 1702 1.82866 CCTGAGTAGGCGGGTCGAT 60.829 63.158 0.0 0.0 37.25 3.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
70 71 2.373169 TGGCTCACCATTATCTGATCCC 59.627 50.000 0.00 0.00 42.67 3.85
105 106 1.265905 GTAGGTCGGCAGTTTGGTTTG 59.734 52.381 0.00 0.00 0.00 2.93
943 950 6.257586 ACCCCTATTGTTTAGTAATTTGGCA 58.742 36.000 0.00 0.00 0.00 4.92
1204 1211 5.105756 CCTTCTACGGCCAAATCTCAATTTT 60.106 40.000 2.24 0.00 32.69 1.82
1299 1306 7.552459 TCTTCGTGATATTGACCACATTTCTA 58.448 34.615 0.00 0.00 33.13 2.10
1936 1948 9.333724 GGATAATCGTCCAGGTCTTATTAAAAA 57.666 33.333 0.00 0.00 38.20 1.94
2056 2069 1.955080 GAGGATCGACCCGTTCAGTAT 59.045 52.381 0.00 0.00 40.05 2.12
2212 2225 0.249398 GTCCGGCTAGCCTTCTTTCA 59.751 55.000 30.55 4.26 0.00 2.69
2214 2227 0.537188 CCGGCTAGCCTTCTTTCAGA 59.463 55.000 30.55 0.00 0.00 3.27
2450 2463 1.114722 TCGACCAACTACCACCGGTT 61.115 55.000 2.97 0.00 37.09 4.44
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
70 71 1.540267 ACCTACTGTCTGTACTGCGTG 59.460 52.381 0.00 0.00 0.00 5.34
105 106 0.532573 TGGGCAAGAGATCGTCAGAC 59.467 55.000 0.00 0.00 0.00 3.51
483 485 1.135699 CGCAAGATGAATGGCGTTGC 61.136 55.000 0.00 0.00 44.11 4.17
605 607 2.905075 CATTGGTCATAGCCGAAGTCA 58.095 47.619 0.00 0.00 0.00 3.41
797 799 0.914902 GAAGAAGTAGTGGGGCCCCT 60.915 60.000 40.66 25.15 36.94 4.79
943 950 4.118168 ACAGTCAATCAAAAGATGGGGT 57.882 40.909 0.00 0.00 0.00 4.95
1299 1306 4.406649 CCCACTGAAATGCAAATAGGGATT 59.593 41.667 0.00 0.00 35.81 3.01
1369 1376 8.230486 GGCGATCATTAGAAATTCACGAATTAT 58.770 33.333 5.48 1.42 39.88 1.28
1473 1480 3.643320 TGATCCCAGCGAATAGAAGATGT 59.357 43.478 0.00 0.00 0.00 3.06
1695 1702 1.828660 CCTGAGTAGGCGGGTCGAT 60.829 63.158 0.00 0.00 37.25 3.59
2056 2069 4.454504 GCCAACAGTCTTTCTTCGGAATTA 59.545 41.667 0.00 0.00 33.58 1.40
2212 2225 1.003696 GTTTAGGCCTGCTTCCTGTCT 59.996 52.381 17.99 0.00 35.21 3.41
2214 2227 0.321653 CGTTTAGGCCTGCTTCCTGT 60.322 55.000 17.99 0.00 35.21 4.00
2450 2463 0.968393 GGTGGCCCAAAGCGGAATTA 60.968 55.000 0.00 0.00 45.17 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.