Multiple sequence alignment - TraesCS3B01G189500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G189500 chr3B 100.000 2372 0 0 1 2372 201615153 201617524 0.000000e+00 4381.0
1 TraesCS3B01G189500 chr3B 100.000 259 0 0 1353 1611 524468319 524468061 1.650000e-131 479.0
2 TraesCS3B01G189500 chr3B 100.000 63 0 0 1927 1989 21185264 21185202 1.490000e-22 117.0
3 TraesCS3B01G189500 chr5B 99.031 2373 22 1 1 2372 44989097 44991469 0.000000e+00 4253.0
4 TraesCS3B01G189500 chr5B 98.693 2372 31 0 1 2372 127808630 127811001 0.000000e+00 4209.0
5 TraesCS3B01G189500 chr1B 98.693 2372 30 1 1 2372 638728835 638731205 0.000000e+00 4207.0
6 TraesCS3B01G189500 chr1B 97.517 2376 54 2 1 2372 135053758 135051384 0.000000e+00 4056.0
7 TraesCS3B01G189500 chr2B 97.476 2179 53 2 1 2179 1454223 1452047 0.000000e+00 3718.0
8 TraesCS3B01G189500 chr7B 99.013 1418 14 0 1 1418 662726601 662728018 0.000000e+00 2542.0
9 TraesCS3B01G189500 chr7B 95.129 698 28 3 1675 2372 47246657 47247348 0.000000e+00 1096.0
10 TraesCS3B01G189500 chr3D 98.874 1421 16 0 1 1421 589263329 589261909 0.000000e+00 2536.0
11 TraesCS3B01G189500 chr3A 98.874 1421 16 0 1 1421 66004936 66003516 0.000000e+00 2536.0
12 TraesCS3B01G189500 chr6D 98.804 1421 17 0 1 1421 389245625 389244205 0.000000e+00 2531.0
13 TraesCS3B01G189500 chr2A 97.614 964 22 1 1409 2372 53948986 53948024 0.000000e+00 1652.0
14 TraesCS3B01G189500 chr7A 97.810 137 3 0 1839 1975 659649765 659649901 1.100000e-58 237.0
15 TraesCS3B01G189500 chr4A 96.512 86 3 0 2206 2291 670459470 670459385 2.460000e-30 143.0
16 TraesCS3B01G189500 chr4B 97.619 42 0 1 1867 1907 104460384 104460425 1.180000e-08 71.3
17 TraesCS3B01G189500 chrUn 97.500 40 1 0 2102 2141 186186806 186186767 4.230000e-08 69.4
18 TraesCS3B01G189500 chrUn 97.500 40 1 0 2102 2141 221556694 221556733 4.230000e-08 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G189500 chr3B 201615153 201617524 2371 False 4381 4381 100.000 1 2372 1 chr3B.!!$F1 2371
1 TraesCS3B01G189500 chr5B 44989097 44991469 2372 False 4253 4253 99.031 1 2372 1 chr5B.!!$F1 2371
2 TraesCS3B01G189500 chr5B 127808630 127811001 2371 False 4209 4209 98.693 1 2372 1 chr5B.!!$F2 2371
3 TraesCS3B01G189500 chr1B 638728835 638731205 2370 False 4207 4207 98.693 1 2372 1 chr1B.!!$F1 2371
4 TraesCS3B01G189500 chr1B 135051384 135053758 2374 True 4056 4056 97.517 1 2372 1 chr1B.!!$R1 2371
5 TraesCS3B01G189500 chr2B 1452047 1454223 2176 True 3718 3718 97.476 1 2179 1 chr2B.!!$R1 2178
6 TraesCS3B01G189500 chr7B 662726601 662728018 1417 False 2542 2542 99.013 1 1418 1 chr7B.!!$F2 1417
7 TraesCS3B01G189500 chr7B 47246657 47247348 691 False 1096 1096 95.129 1675 2372 1 chr7B.!!$F1 697
8 TraesCS3B01G189500 chr3D 589261909 589263329 1420 True 2536 2536 98.874 1 1421 1 chr3D.!!$R1 1420
9 TraesCS3B01G189500 chr3A 66003516 66004936 1420 True 2536 2536 98.874 1 1421 1 chr3A.!!$R1 1420
10 TraesCS3B01G189500 chr6D 389244205 389245625 1420 True 2531 2531 98.804 1 1421 1 chr6D.!!$R1 1420
11 TraesCS3B01G189500 chr2A 53948024 53948986 962 True 1652 1652 97.614 1409 2372 1 chr2A.!!$R1 963

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
787 789 1.152204 TCCCCGTTCCTGGTTCTCA 60.152 57.895 0.0 0.0 0.0 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2079 2085 2.945668 GGGCTAAACGAAAGATCATGCT 59.054 45.455 0.0 0.0 0.0 3.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
787 789 1.152204 TCCCCGTTCCTGGTTCTCA 60.152 57.895 0.00 0.0 0.00 3.27
1176 1182 4.131596 GGCATAGCCTTAACGTTAATGGA 58.868 43.478 26.88 15.2 46.69 3.41
1237 1243 1.984570 CCAGAGACGAGGAAGGGCA 60.985 63.158 0.00 0.0 0.00 5.36
1637 1643 3.644606 CACTCAGCAGGCAGGGGT 61.645 66.667 0.00 0.0 0.00 4.95
2079 2085 2.984435 TATACCGAGTATGCCCCTCA 57.016 50.000 6.77 0.0 30.79 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
271 273 6.824196 GTCCTCTTCCCCATTACTTAGAAAAG 59.176 42.308 0.00 0.0 38.77 2.27
787 789 1.887797 TCCGGGGAATCCAGTTACAT 58.112 50.000 0.00 0.0 34.36 2.29
1176 1182 3.139211 AGCCTTTCCTCTTTTGAACCTCT 59.861 43.478 0.00 0.0 0.00 3.69
1237 1243 1.656652 AGCATTTCGTCGCTTGCTAT 58.343 45.000 12.66 0.0 43.28 2.97
1637 1643 6.604396 TGTCTACCGATTTTGGATAGTGAGTA 59.396 38.462 0.00 0.0 0.00 2.59
2079 2085 2.945668 GGGCTAAACGAAAGATCATGCT 59.054 45.455 0.00 0.0 0.00 3.79
2249 2255 4.019858 CACAGATCCTTCTCCAGAGTACA 58.980 47.826 0.00 0.0 0.00 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.