Multiple sequence alignment - TraesCS3B01G189300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G189300 chr3B 100.000 2273 0 0 1 2273 201565401 201563129 0.000000e+00 4198
1 TraesCS3B01G189300 chr3B 92.140 229 16 1 2035 2263 143541644 143541418 2.820000e-84 322
2 TraesCS3B01G189300 chr7B 98.856 2273 25 1 1 2273 662732894 662735165 0.000000e+00 4052
3 TraesCS3B01G189300 chr7B 98.831 1625 19 0 1 1625 622431988 622430364 0.000000e+00 2896
4 TraesCS3B01G189300 chr1D 98.284 2273 38 1 1 2273 254531578 254533849 0.000000e+00 3980
5 TraesCS3B01G189300 chr3A 98.241 2274 37 3 1 2273 672883048 672880777 0.000000e+00 3975
6 TraesCS3B01G189300 chr3A 97.991 2240 45 0 1 2240 695636380 695638619 0.000000e+00 3888
7 TraesCS3B01G189300 chr1B 98.153 2274 39 3 1 2273 633733490 633731219 0.000000e+00 3964
8 TraesCS3B01G189300 chr6B 97.498 2278 36 10 1 2273 615601610 615599349 0.000000e+00 3871
9 TraesCS3B01G189300 chr2A 98.965 2125 22 0 1 2125 543187641 543189765 0.000000e+00 3803
10 TraesCS3B01G189300 chr2A 97.015 402 10 2 1873 2273 394050573 394050973 0.000000e+00 675
11 TraesCS3B01G189300 chr7A 94.708 1795 82 8 483 2273 352681573 352679788 0.000000e+00 2776
12 TraesCS3B01G189300 chr2B 95.028 181 8 1 1628 1808 91085305 91085484 1.330000e-72 283


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G189300 chr3B 201563129 201565401 2272 True 4198 4198 100.000 1 2273 1 chr3B.!!$R2 2272
1 TraesCS3B01G189300 chr7B 662732894 662735165 2271 False 4052 4052 98.856 1 2273 1 chr7B.!!$F1 2272
2 TraesCS3B01G189300 chr7B 622430364 622431988 1624 True 2896 2896 98.831 1 1625 1 chr7B.!!$R1 1624
3 TraesCS3B01G189300 chr1D 254531578 254533849 2271 False 3980 3980 98.284 1 2273 1 chr1D.!!$F1 2272
4 TraesCS3B01G189300 chr3A 672880777 672883048 2271 True 3975 3975 98.241 1 2273 1 chr3A.!!$R1 2272
5 TraesCS3B01G189300 chr3A 695636380 695638619 2239 False 3888 3888 97.991 1 2240 1 chr3A.!!$F1 2239
6 TraesCS3B01G189300 chr1B 633731219 633733490 2271 True 3964 3964 98.153 1 2273 1 chr1B.!!$R1 2272
7 TraesCS3B01G189300 chr6B 615599349 615601610 2261 True 3871 3871 97.498 1 2273 1 chr6B.!!$R1 2272
8 TraesCS3B01G189300 chr2A 543187641 543189765 2124 False 3803 3803 98.965 1 2125 1 chr2A.!!$F2 2124
9 TraesCS3B01G189300 chr7A 352679788 352681573 1785 True 2776 2776 94.708 483 2273 1 chr7A.!!$R1 1790

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
132 133 6.570692 GGATCTGAATTTGACTGAAATGCAT 58.429 36.0 0.0 0.0 38.68 3.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1655 1659 5.895636 TCTGGTGCATTTACTGTTATTGG 57.104 39.13 0.0 0.0 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 133 6.570692 GGATCTGAATTTGACTGAAATGCAT 58.429 36.000 0.00 0.0 38.68 3.96
186 187 6.863275 CCTAAAAGGTGGAATAGCGATTTTT 58.137 36.000 0.00 0.0 0.00 1.94
955 956 7.695201 TGTGTGTACGAGATTAGAATAACTTCG 59.305 37.037 0.00 0.0 36.45 3.79
1933 1941 4.080863 GCCGATCTACCTTATGGATGGATT 60.081 45.833 0.81 0.0 37.04 3.01
2200 2208 1.272769 GGGGATTCGTTAGCTCGCTAT 59.727 52.381 0.00 0.0 0.00 2.97
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
98 99 6.017440 AGTCAAATTCAGATCCGTTTTTCGAA 60.017 34.615 0.00 0.0 42.86 3.71
132 133 6.650807 GTGAAAAGTGATACCTGTGAAGATCA 59.349 38.462 0.00 0.0 0.00 2.92
186 187 7.872138 ACCATTCTCTTATAGGAAATGGTTCA 58.128 34.615 23.48 0.0 33.75 3.18
928 929 9.517609 GAAGTTATTCTAATCTCGTACACACAT 57.482 33.333 0.00 0.0 32.33 3.21
1514 1518 6.891361 TCACAATCAATAACATCCTCACCATT 59.109 34.615 0.00 0.0 0.00 3.16
1650 1654 6.943146 TGGTGCATTTACTGTTATTGGTTCTA 59.057 34.615 0.00 0.0 0.00 2.10
1655 1659 5.895636 TCTGGTGCATTTACTGTTATTGG 57.104 39.130 0.00 0.0 0.00 3.16
2200 2208 5.929992 CCTCATTTCACCAACTCGTACTAAA 59.070 40.000 0.00 0.0 0.00 1.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.