Multiple sequence alignment - TraesCS3B01G189200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G189200 chr3B 100.000 2213 0 0 1 2213 201561889 201559677 0.000000e+00 4087.0
1 TraesCS3B01G189200 chr3B 97.619 126 3 0 1 126 728215814 728215689 1.330000e-52 217.0
2 TraesCS3B01G189200 chr3B 87.129 101 9 1 54 150 696111671 696111771 6.460000e-21 111.0
3 TraesCS3B01G189200 chr3B 95.918 49 2 0 1 49 647458466 647458514 1.820000e-11 80.5
4 TraesCS3B01G189200 chr1B 98.012 2213 41 3 1 2213 633729978 633727769 0.000000e+00 3840.0
5 TraesCS3B01G189200 chr3A 97.381 2215 46 6 1 2213 672879541 672877337 0.000000e+00 3759.0
6 TraesCS3B01G189200 chr2D 97.117 2220 33 14 1 2213 272802771 272800576 0.000000e+00 3716.0
7 TraesCS3B01G189200 chr2D 97.791 1811 28 3 3 1808 630268117 630269920 0.000000e+00 3112.0
8 TraesCS3B01G189200 chr2D 98.203 1614 22 1 600 2213 33933300 33934906 0.000000e+00 2813.0
9 TraesCS3B01G189200 chr2D 97.913 1150 17 1 1064 2213 630270241 630271383 0.000000e+00 1984.0
10 TraesCS3B01G189200 chr5B 96.161 2214 70 7 1 2213 432875618 432877817 0.000000e+00 3603.0
11 TraesCS3B01G189200 chr5B 98.434 511 8 0 1703 2213 413608022 413608532 0.000000e+00 900.0
12 TraesCS3B01G189200 chr5D 95.942 2218 71 10 1 2213 432293825 432291622 0.000000e+00 3579.0
13 TraesCS3B01G189200 chr4A 95.217 2216 91 7 1 2213 310761300 310763503 0.000000e+00 3491.0
14 TraesCS3B01G189200 chr4A 94.765 2216 78 15 1 2213 219340970 219338790 0.000000e+00 3415.0
15 TraesCS3B01G189200 chr7A 93.733 2218 103 15 1 2213 352678554 352676368 0.000000e+00 3293.0
16 TraesCS3B01G189200 chr2A 99.333 150 0 1 98 246 393117389 393117538 1.010000e-68 270.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G189200 chr3B 201559677 201561889 2212 True 4087 4087 100.000 1 2213 1 chr3B.!!$R1 2212
1 TraesCS3B01G189200 chr1B 633727769 633729978 2209 True 3840 3840 98.012 1 2213 1 chr1B.!!$R1 2212
2 TraesCS3B01G189200 chr3A 672877337 672879541 2204 True 3759 3759 97.381 1 2213 1 chr3A.!!$R1 2212
3 TraesCS3B01G189200 chr2D 272800576 272802771 2195 True 3716 3716 97.117 1 2213 1 chr2D.!!$R1 2212
4 TraesCS3B01G189200 chr2D 33933300 33934906 1606 False 2813 2813 98.203 600 2213 1 chr2D.!!$F1 1613
5 TraesCS3B01G189200 chr2D 630268117 630271383 3266 False 2548 3112 97.852 3 2213 2 chr2D.!!$F2 2210
6 TraesCS3B01G189200 chr5B 432875618 432877817 2199 False 3603 3603 96.161 1 2213 1 chr5B.!!$F2 2212
7 TraesCS3B01G189200 chr5B 413608022 413608532 510 False 900 900 98.434 1703 2213 1 chr5B.!!$F1 510
8 TraesCS3B01G189200 chr5D 432291622 432293825 2203 True 3579 3579 95.942 1 2213 1 chr5D.!!$R1 2212
9 TraesCS3B01G189200 chr4A 310761300 310763503 2203 False 3491 3491 95.217 1 2213 1 chr4A.!!$F1 2212
10 TraesCS3B01G189200 chr4A 219338790 219340970 2180 True 3415 3415 94.765 1 2213 1 chr4A.!!$R1 2212
11 TraesCS3B01G189200 chr7A 352676368 352678554 2186 True 3293 3293 93.733 1 2213 1 chr7A.!!$R1 2212

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
572 593 2.557452 CCAGGGGCTAGGAACAAAACAT 60.557 50.0 0.0 0.0 0.0 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1546 2094 6.462768 CCTTTTCAAATCTCCAATCCACAACA 60.463 38.462 0.0 0.0 0.0 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
299 304 9.989296 TTTTTCATTATTTCCTTCCTCTATCCA 57.011 29.630 0.00 0.00 0.00 3.41
343 355 4.523083 TGCTCATGAACTAATACCCAACC 58.477 43.478 0.00 0.00 0.00 3.77
572 593 2.557452 CCAGGGGCTAGGAACAAAACAT 60.557 50.000 0.00 0.00 0.00 2.71
867 888 6.485171 AGCAGGTTACCAAACTGAATATTCT 58.515 36.000 16.24 0.00 35.81 2.40
1119 1142 5.205821 TGGACTTTACCGAGGATGAGAATA 58.794 41.667 0.00 0.00 0.00 1.75
1263 1286 4.536364 TTTCAACACAAAAGCTCTCTCG 57.464 40.909 0.00 0.00 0.00 4.04
1377 1925 3.160777 ACGTGCTACAAGGTACATAGC 57.839 47.619 9.52 9.52 41.44 2.97
1546 2094 3.940221 GCGTATGTCCGATAGATCTACCT 59.060 47.826 4.10 0.00 39.76 3.08
1667 2755 4.814771 AGTACTGTCCAACAAGCTGTTTAC 59.185 41.667 0.00 0.00 38.77 2.01
1748 2836 5.622770 AATTGCTTTAAGTCGGTTACCAG 57.377 39.130 1.13 0.00 0.00 4.00
2199 3288 4.472690 AGGGGGTCTAGGAGTAGTATTG 57.527 50.000 0.00 0.00 0.00 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
51 52 7.645058 TCCTTTTATGGGCAAAAATCTCTAG 57.355 36.000 0.00 0.0 0.00 2.43
296 301 8.745590 CAATTCTGCATGAATATGGATAATGGA 58.254 33.333 10.51 0.0 43.99 3.41
297 302 8.926715 CAATTCTGCATGAATATGGATAATGG 57.073 34.615 10.51 0.0 43.99 3.16
572 593 8.605947 TCTCTATGATCAGAAAAAGGAAAGGAA 58.394 33.333 0.09 0.0 0.00 3.36
934 955 0.741221 CCGCCCAAGTAGAGAACTGC 60.741 60.000 0.00 0.0 38.88 4.40
1319 1867 3.418684 ACTCATGAACCCAGTTACCAC 57.581 47.619 0.00 0.0 0.00 4.16
1377 1925 9.110502 GGGATAAGGTAGTTATGAAACTTTGAG 57.889 37.037 0.00 0.0 43.60 3.02
1546 2094 6.462768 CCTTTTCAAATCTCCAATCCACAACA 60.463 38.462 0.00 0.0 0.00 3.33
1667 2755 8.954350 AGAAAGTTCATATTCTTCAGTCATTGG 58.046 33.333 0.00 0.0 32.05 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.