Multiple sequence alignment - TraesCS3B01G189100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G189100 chr3B 100.000 2549 0 0 1 2549 201561585 201559037 0 4708
1 TraesCS3B01G189100 chr1B 97.921 2549 51 2 1 2549 633729675 633727129 0 4412
2 TraesCS3B01G189100 chr3A 97.725 2549 54 4 1 2549 672879242 672876698 0 4383
3 TraesCS3B01G189100 chr5D 96.671 2553 76 8 1 2549 432293530 432290983 0 4235
4 TraesCS3B01G189100 chr5B 96.701 2516 77 4 1 2515 432875914 432878424 0 4181
5 TraesCS3B01G189100 chr5B 98.092 1153 20 1 1399 2549 413608022 413609174 0 2006
6 TraesCS3B01G189100 chr4A 96.072 2546 96 3 1 2544 310761595 310764138 0 4145
7 TraesCS3B01G189100 chr4A 95.178 2551 98 11 1 2549 219340679 219338152 0 4006
8 TraesCS3B01G189100 chr7A 93.406 2563 125 23 1 2549 352678256 352675724 0 3757
9 TraesCS3B01G189100 chr2D 97.437 1990 31 6 1 1985 272802474 272800500 0 3374
10 TraesCS3B01G189100 chr2D 98.212 1790 25 1 760 2549 630270241 630272023 0 3121
11 TraesCS3B01G189100 chr2D 98.474 1507 19 1 2 1504 630268414 630269920 0 2652
12 TraesCS3B01G189100 chr4D 96.277 1558 56 2 992 2549 245648863 245650418 0 2555
13 TraesCS3B01G189100 chr5A 97.520 1008 25 0 1120 2127 442270687 442271694 0 1724


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G189100 chr3B 201559037 201561585 2548 True 4708.0 4708 100.000 1 2549 1 chr3B.!!$R1 2548
1 TraesCS3B01G189100 chr1B 633727129 633729675 2546 True 4412.0 4412 97.921 1 2549 1 chr1B.!!$R1 2548
2 TraesCS3B01G189100 chr3A 672876698 672879242 2544 True 4383.0 4383 97.725 1 2549 1 chr3A.!!$R1 2548
3 TraesCS3B01G189100 chr5D 432290983 432293530 2547 True 4235.0 4235 96.671 1 2549 1 chr5D.!!$R1 2548
4 TraesCS3B01G189100 chr5B 432875914 432878424 2510 False 4181.0 4181 96.701 1 2515 1 chr5B.!!$F2 2514
5 TraesCS3B01G189100 chr5B 413608022 413609174 1152 False 2006.0 2006 98.092 1399 2549 1 chr5B.!!$F1 1150
6 TraesCS3B01G189100 chr4A 310761595 310764138 2543 False 4145.0 4145 96.072 1 2544 1 chr4A.!!$F1 2543
7 TraesCS3B01G189100 chr4A 219338152 219340679 2527 True 4006.0 4006 95.178 1 2549 1 chr4A.!!$R1 2548
8 TraesCS3B01G189100 chr7A 352675724 352678256 2532 True 3757.0 3757 93.406 1 2549 1 chr7A.!!$R1 2548
9 TraesCS3B01G189100 chr2D 272800500 272802474 1974 True 3374.0 3374 97.437 1 1985 1 chr2D.!!$R1 1984
10 TraesCS3B01G189100 chr2D 630268414 630272023 3609 False 2886.5 3121 98.343 2 2549 2 chr2D.!!$F1 2547
11 TraesCS3B01G189100 chr4D 245648863 245650418 1555 False 2555.0 2555 96.277 992 2549 1 chr4D.!!$F1 1557
12 TraesCS3B01G189100 chr5A 442270687 442271694 1007 False 1724.0 1724 97.520 1120 2127 1 chr5A.!!$F1 1007

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
268 274 2.557452 CCAGGGGCTAGGAACAAAACAT 60.557 50.0 0.0 0.0 0.0 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2008 3091 3.737559 AGACATTTATGGCTCCCACAA 57.262 42.857 0.0 0.0 44.6 3.33 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
39 40 4.523083 TGCTCATGAACTAATACCCAACC 58.477 43.478 0.00 0.00 0.00 3.77
268 274 2.557452 CCAGGGGCTAGGAACAAAACAT 60.557 50.000 0.00 0.00 0.00 2.71
563 569 6.485171 AGCAGGTTACCAAACTGAATATTCT 58.515 36.000 16.24 0.00 35.81 2.40
815 823 5.205821 TGGACTTTACCGAGGATGAGAATA 58.794 41.667 0.00 0.00 0.00 1.75
959 967 4.536364 TTTCAACACAAAAGCTCTCTCG 57.464 40.909 0.00 0.00 0.00 4.04
1073 1606 3.160777 ACGTGCTACAAGGTACATAGC 57.839 47.619 9.52 9.52 41.44 2.97
1363 2436 4.814771 AGTACTGTCCAACAAGCTGTTTAC 59.185 41.667 0.00 0.00 38.77 2.01
1444 2517 5.622770 AATTGCTTTAAGTCGGTTACCAG 57.377 39.130 1.13 0.00 0.00 4.00
1895 2976 4.472690 AGGGGGTCTAGGAGTAGTATTG 57.527 50.000 0.00 0.00 0.00 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
268 274 8.605947 TCTCTATGATCAGAAAAAGGAAAGGAA 58.394 33.333 0.09 0.0 0.00 3.36
630 636 0.741221 CCGCCCAAGTAGAGAACTGC 60.741 60.000 0.00 0.0 38.88 4.40
1073 1606 9.110502 GGGATAAGGTAGTTATGAAACTTTGAG 57.889 37.037 0.00 0.0 43.60 3.02
1363 2436 8.954350 AGAAAGTTCATATTCTTCAGTCATTGG 58.046 33.333 0.00 0.0 32.05 3.16
1895 2976 4.441495 GCAGAATAAATGGGGTTGGTAAGC 60.441 45.833 0.00 0.0 0.00 3.09
2008 3091 3.737559 AGACATTTATGGCTCCCACAA 57.262 42.857 0.00 0.0 44.60 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.