Multiple sequence alignment - TraesCS3B01G189000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G189000 chr3B 100.000 2531 0 0 1 2531 201560773 201558243 0 4674
1 TraesCS3B01G189000 chr3B 91.630 920 41 5 1609 2528 260376862 260377745 0 1240
2 TraesCS3B01G189000 chr3B 92.830 795 35 6 1754 2531 703007384 703006595 0 1133
3 TraesCS3B01G189000 chr2D 96.922 2567 35 5 1 2531 630270294 630272852 0 4263
4 TraesCS3B01G189000 chr2D 96.770 2570 36 6 1 2531 33933817 33936378 0 4242
5 TraesCS3B01G189000 chr3A 96.843 2502 52 9 1 2481 672878431 672875936 0 4157
6 TraesCS3B01G189000 chr4A 95.772 2531 102 3 1 2531 310762407 310764932 0 4076
7 TraesCS3B01G189000 chr4A 94.789 710 30 5 1822 2531 219308174 219307472 0 1099
8 TraesCS3B01G189000 chr5B 95.526 2548 79 8 1 2531 432876725 432879254 0 4041
9 TraesCS3B01G189000 chr5B 97.350 1962 31 5 587 2528 413608022 413609982 0 3315
10 TraesCS3B01G189000 chr4D 95.608 2368 82 6 180 2531 245648863 245651224 0 3777
11 TraesCS3B01G189000 chr1B 97.753 2047 43 3 1 2046 633728863 633726819 0 3522
12 TraesCS3B01G189000 chr5D 95.859 2125 63 10 1 2106 432292717 432290599 0 3413
13 TraesCS3B01G189000 chr1A 95.120 1537 48 6 1010 2528 371922144 371923671 0 2398
14 TraesCS3B01G189000 chr1A 94.089 1015 51 5 1 1012 371831415 371832423 0 1533
15 TraesCS3B01G189000 chrUn 98.387 496 7 1 2037 2531 451362730 451363225 0 870
16 TraesCS3B01G189000 chr5A 98.384 495 6 1 2037 2531 482027333 482026841 0 869


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G189000 chr3B 201558243 201560773 2530 True 4674 4674 100.000 1 2531 1 chr3B.!!$R1 2530
1 TraesCS3B01G189000 chr3B 260376862 260377745 883 False 1240 1240 91.630 1609 2528 1 chr3B.!!$F1 919
2 TraesCS3B01G189000 chr3B 703006595 703007384 789 True 1133 1133 92.830 1754 2531 1 chr3B.!!$R2 777
3 TraesCS3B01G189000 chr2D 630270294 630272852 2558 False 4263 4263 96.922 1 2531 1 chr2D.!!$F2 2530
4 TraesCS3B01G189000 chr2D 33933817 33936378 2561 False 4242 4242 96.770 1 2531 1 chr2D.!!$F1 2530
5 TraesCS3B01G189000 chr3A 672875936 672878431 2495 True 4157 4157 96.843 1 2481 1 chr3A.!!$R1 2480
6 TraesCS3B01G189000 chr4A 310762407 310764932 2525 False 4076 4076 95.772 1 2531 1 chr4A.!!$F1 2530
7 TraesCS3B01G189000 chr4A 219307472 219308174 702 True 1099 1099 94.789 1822 2531 1 chr4A.!!$R1 709
8 TraesCS3B01G189000 chr5B 432876725 432879254 2529 False 4041 4041 95.526 1 2531 1 chr5B.!!$F2 2530
9 TraesCS3B01G189000 chr5B 413608022 413609982 1960 False 3315 3315 97.350 587 2528 1 chr5B.!!$F1 1941
10 TraesCS3B01G189000 chr4D 245648863 245651224 2361 False 3777 3777 95.608 180 2531 1 chr4D.!!$F1 2351
11 TraesCS3B01G189000 chr1B 633726819 633728863 2044 True 3522 3522 97.753 1 2046 1 chr1B.!!$R1 2045
12 TraesCS3B01G189000 chr5D 432290599 432292717 2118 True 3413 3413 95.859 1 2106 1 chr5D.!!$R1 2105
13 TraesCS3B01G189000 chr1A 371922144 371923671 1527 False 2398 2398 95.120 1010 2528 1 chr1A.!!$F2 1518
14 TraesCS3B01G189000 chr1A 371831415 371832423 1008 False 1533 1533 94.089 1 1012 1 chr1A.!!$F1 1011

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
261 264 3.160777 ACGTGCTACAAGGTACATAGC 57.839 47.619 9.52 9.52 41.44 2.97 F
430 433 3.940221 GCGTATGTCCGATAGATCTACCT 59.060 47.826 4.10 0.00 39.76 3.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1196 1211 3.737559 AGACATTTATGGCTCCCACAA 57.262 42.857 0.0 0.0 44.6 3.33 R
2321 2408 7.173907 TGAAGAGAGCCAAGAGACTTTAATTTG 59.826 37.037 0.0 0.0 0.0 2.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
147 148 4.536364 TTTCAACACAAAAGCTCTCTCG 57.464 40.909 0.00 0.00 0.00 4.04
261 264 3.160777 ACGTGCTACAAGGTACATAGC 57.839 47.619 9.52 9.52 41.44 2.97
430 433 3.940221 GCGTATGTCCGATAGATCTACCT 59.060 47.826 4.10 0.00 39.76 3.08
551 554 4.814771 AGTACTGTCCAACAAGCTGTTTAC 59.185 41.667 0.00 0.00 38.77 2.01
632 635 5.622770 AATTGCTTTAAGTCGGTTACCAG 57.377 39.130 1.13 0.00 0.00 4.00
1083 1095 4.472690 AGGGGGTCTAGGAGTAGTATTG 57.527 50.000 0.00 0.00 0.00 1.90
2011 2036 5.720202 TCCATCCATCGTAATAGGAAATCG 58.280 41.667 0.00 0.00 34.62 3.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
261 264 9.110502 GGGATAAGGTAGTTATGAAACTTTGAG 57.889 37.037 0.00 0.0 43.60 3.02
430 433 6.462768 CCTTTTCAAATCTCCAATCCACAACA 60.463 38.462 0.00 0.0 0.00 3.33
551 554 8.954350 AGAAAGTTCATATTCTTCAGTCATTGG 58.046 33.333 0.00 0.0 32.05 3.16
806 809 8.476925 CCAATAAGCAGTAGTTTTTCGTTTTTC 58.523 33.333 0.00 0.0 0.00 2.29
807 810 8.192110 TCCAATAAGCAGTAGTTTTTCGTTTTT 58.808 29.630 0.00 0.0 0.00 1.94
808 811 7.708998 TCCAATAAGCAGTAGTTTTTCGTTTT 58.291 30.769 0.00 0.0 0.00 2.43
809 812 7.266922 TCCAATAAGCAGTAGTTTTTCGTTT 57.733 32.000 0.00 0.0 0.00 3.60
810 813 6.870971 TCCAATAAGCAGTAGTTTTTCGTT 57.129 33.333 0.00 0.0 0.00 3.85
811 814 6.870971 TTCCAATAAGCAGTAGTTTTTCGT 57.129 33.333 0.00 0.0 0.00 3.85
812 815 8.742554 AATTTCCAATAAGCAGTAGTTTTTCG 57.257 30.769 0.00 0.0 0.00 3.46
1083 1095 4.441495 GCAGAATAAATGGGGTTGGTAAGC 60.441 45.833 0.00 0.0 0.00 3.09
1175 1190 6.252441 CACAAAAATAAGAAGTTGTGCGACAA 59.748 34.615 2.77 0.0 42.94 3.18
1196 1211 3.737559 AGACATTTATGGCTCCCACAA 57.262 42.857 0.00 0.0 44.60 3.33
1732 1747 8.671921 CATGCTCAAACATCATTAACTAACTCT 58.328 33.333 0.00 0.0 0.00 3.24
1787 1803 7.229306 GCTTGTGATCAATCCATAGATACCAAA 59.771 37.037 0.00 0.0 32.82 3.28
1882 1907 7.768582 TGGCGACTATCAAATAGATCAGAAAAA 59.231 33.333 0.00 0.0 38.19 1.94
2321 2408 7.173907 TGAAGAGAGCCAAGAGACTTTAATTTG 59.826 37.037 0.00 0.0 0.00 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.