Multiple sequence alignment - TraesCS3B01G188900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G188900 chr3B 100.000 2246 0 0 1 2246 201559264 201557019 0.000000e+00 4148
1 TraesCS3B01G188900 chr3B 94.112 2021 90 11 245 2246 703007384 703005374 0.000000e+00 3046
2 TraesCS3B01G188900 chr3B 92.714 1743 68 19 100 1839 260376862 260378548 0.000000e+00 2460
3 TraesCS3B01G188900 chr2D 97.027 2287 26 7 1 2246 630271796 630274081 0.000000e+00 3808
4 TraesCS3B01G188900 chr2D 96.943 2290 25 6 1 2246 33935320 33937608 0.000000e+00 3799
5 TraesCS3B01G188900 chr5B 96.915 2269 43 8 1 2246 413608947 413611211 0.000000e+00 3777
6 TraesCS3B01G188900 chr5B 95.656 2256 48 25 1 2246 429038191 429040406 0.000000e+00 3578
7 TraesCS3B01G188900 chr1A 94.110 2275 77 16 1 2246 371922644 371924890 0.000000e+00 3406
8 TraesCS3B01G188900 chr4A 95.297 1935 80 8 313 2246 219308174 219306250 0.000000e+00 3059
9 TraesCS3B01G188900 chr4A 95.721 1823 69 6 1 1822 310763916 310765730 0.000000e+00 2926
10 TraesCS3B01G188900 chr5A 98.549 1723 19 3 528 2246 482027333 482025613 0.000000e+00 3038
11 TraesCS3B01G188900 chr1D 97.834 1339 24 4 911 2246 254419186 254420522 0.000000e+00 2307
12 TraesCS3B01G188900 chrUn 95.330 1135 14 4 1 1097 371049957 371051090 0.000000e+00 1766
13 TraesCS3B01G188900 chr7A 92.013 1202 57 7 1 1184 352675947 352674767 0.000000e+00 1652
14 TraesCS3B01G188900 chr7A 97.714 175 1 2 528 702 731392037 731392208 4.690000e-77 298
15 TraesCS3B01G188900 chr3A 95.770 993 17 7 1 972 672876924 672875936 0.000000e+00 1578
16 TraesCS3B01G188900 chr7D 98.776 735 5 2 1516 2246 231529011 231529745 0.000000e+00 1304
17 TraesCS3B01G188900 chr1B 97.955 538 10 1 1 537 633727356 633726819 0.000000e+00 931


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G188900 chr3B 201557019 201559264 2245 True 4148 4148 100.000 1 2246 1 chr3B.!!$R1 2245
1 TraesCS3B01G188900 chr3B 703005374 703007384 2010 True 3046 3046 94.112 245 2246 1 chr3B.!!$R2 2001
2 TraesCS3B01G188900 chr3B 260376862 260378548 1686 False 2460 2460 92.714 100 1839 1 chr3B.!!$F1 1739
3 TraesCS3B01G188900 chr2D 630271796 630274081 2285 False 3808 3808 97.027 1 2246 1 chr2D.!!$F2 2245
4 TraesCS3B01G188900 chr2D 33935320 33937608 2288 False 3799 3799 96.943 1 2246 1 chr2D.!!$F1 2245
5 TraesCS3B01G188900 chr5B 413608947 413611211 2264 False 3777 3777 96.915 1 2246 1 chr5B.!!$F1 2245
6 TraesCS3B01G188900 chr5B 429038191 429040406 2215 False 3578 3578 95.656 1 2246 1 chr5B.!!$F2 2245
7 TraesCS3B01G188900 chr1A 371922644 371924890 2246 False 3406 3406 94.110 1 2246 1 chr1A.!!$F1 2245
8 TraesCS3B01G188900 chr4A 219306250 219308174 1924 True 3059 3059 95.297 313 2246 1 chr4A.!!$R1 1933
9 TraesCS3B01G188900 chr4A 310763916 310765730 1814 False 2926 2926 95.721 1 1822 1 chr4A.!!$F1 1821
10 TraesCS3B01G188900 chr5A 482025613 482027333 1720 True 3038 3038 98.549 528 2246 1 chr5A.!!$R1 1718
11 TraesCS3B01G188900 chr1D 254419186 254420522 1336 False 2307 2307 97.834 911 2246 1 chr1D.!!$F1 1335
12 TraesCS3B01G188900 chrUn 371049957 371051090 1133 False 1766 1766 95.330 1 1097 1 chrUn.!!$F1 1096
13 TraesCS3B01G188900 chr7A 352674767 352675947 1180 True 1652 1652 92.013 1 1184 1 chr7A.!!$R1 1183
14 TraesCS3B01G188900 chr3A 672875936 672876924 988 True 1578 1578 95.770 1 972 1 chr3A.!!$R1 971
15 TraesCS3B01G188900 chr7D 231529011 231529745 734 False 1304 1304 98.776 1516 2246 1 chr7D.!!$F1 730
16 TraesCS3B01G188900 chr1B 633726819 633727356 537 True 931 931 97.955 1 537 1 chr1B.!!$R1 536

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
502 513 5.720202 TCCATCCATCGTAATAGGAAATCG 58.28 41.667 0.0 0.0 34.62 3.34 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1975 2084 3.806949 AGTATTTCCAAGGTTGCAGGA 57.193 42.857 0.0 0.0 0.0 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
502 513 5.720202 TCCATCCATCGTAATAGGAAATCG 58.280 41.667 0.00 0.0 34.62 3.34
1067 1140 2.605837 TGTGTACGAGCTTGTCCAAA 57.394 45.000 10.71 0.0 0.00 3.28
1414 1506 5.596845 ACTTGTTGTTTTGCCGATATTTGT 58.403 33.333 0.00 0.0 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
278 280 7.229306 GCTTGTGATCAATCCATAGATACCAAA 59.771 37.037 0.00 0.00 32.82 3.28
373 384 7.768582 TGGCGACTATCAAATAGATCAGAAAAA 59.231 33.333 0.00 0.00 38.19 1.94
812 883 7.173907 TGAAGAGAGCCAAGAGACTTTAATTTG 59.826 37.037 0.00 0.00 0.00 2.32
1024 1097 8.159447 ACATTGAGTGCATCCTATACATGTATT 58.841 33.333 22.90 8.14 0.00 1.89
1067 1140 8.386264 CCCAGGGTATCATTTCTAATACATCTT 58.614 37.037 0.00 0.00 31.33 2.40
1134 1207 5.042463 TCTTACAACCCACACAATCTTCA 57.958 39.130 0.00 0.00 0.00 3.02
1330 1422 6.687081 AAAGACAAGATACGTTTTGACCAA 57.313 33.333 12.27 0.00 0.00 3.67
1893 2002 4.503296 CCATACCCAGAACTCCGATTAAGG 60.503 50.000 0.00 0.00 0.00 2.69
1975 2084 3.806949 AGTATTTCCAAGGTTGCAGGA 57.193 42.857 0.00 0.00 0.00 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.