Multiple sequence alignment - TraesCS3B01G188800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G188800 chr3B 100.000 3362 0 0 1 3362 201558762 201555401 0.000000e+00 6209.0
1 TraesCS3B01G188800 chr3B 94.387 3100 134 19 26 3119 703007085 703004020 0.000000e+00 4724.0
2 TraesCS3B01G188800 chr5A 98.655 3346 34 5 26 3362 482027333 482023990 0.000000e+00 5919.0
3 TraesCS3B01G188800 chr5B 97.044 3248 70 11 125 3362 429038785 429042016 0.000000e+00 5443.0
4 TraesCS3B01G188800 chr5B 97.862 3134 56 7 26 3152 413609491 413612620 0.000000e+00 5406.0
5 TraesCS3B01G188800 chr4A 95.754 3368 126 12 2 3362 219307983 219304626 0.000000e+00 5411.0
6 TraesCS3B01G188800 chr4A 97.053 2036 48 8 1334 3362 310766007 310768037 0.000000e+00 3417.0
7 TraesCS3B01G188800 chr4A 95.606 1320 51 5 2 1320 310764417 310765730 0.000000e+00 2109.0
8 TraesCS3B01G188800 chr2D 97.558 2826 30 7 26 2818 33935864 33938683 0.000000e+00 4800.0
9 TraesCS3B01G188800 chr2D 97.726 2507 27 6 26 2503 630272340 630274845 0.000000e+00 4287.0
10 TraesCS3B01G188800 chr6D 96.298 2836 83 11 264 3086 322234700 322237526 0.000000e+00 4636.0
11 TraesCS3B01G188800 chr1D 97.871 2255 38 5 409 2655 254419186 254421438 0.000000e+00 3890.0
12 TraesCS3B01G188800 chr3D 97.769 1210 21 2 2159 3362 158929682 158930891 0.000000e+00 2080.0
13 TraesCS3B01G188800 chr3D 97.686 1210 22 2 2159 3362 158935797 158937006 0.000000e+00 2074.0
14 TraesCS3B01G188800 chr7A 91.945 658 35 4 26 682 352675407 352674767 0.000000e+00 905.0
15 TraesCS3B01G188800 chr7A 97.714 175 1 2 26 200 731392037 731392208 7.050000e-77 298.0
16 TraesCS3B01G188800 chrUn 95.709 536 6 5 2 520 451362690 451363225 0.000000e+00 846.0
17 TraesCS3B01G188800 chrUn 98.964 193 1 1 26 217 451362409 451362217 8.930000e-91 344.0
18 TraesCS3B01G188800 chrUn 100.000 38 0 0 2 39 8039676 8039639 1.670000e-08 71.3
19 TraesCS3B01G188800 chrUn 100.000 38 0 0 2 39 8042549 8042512 1.670000e-08 71.3
20 TraesCS3B01G188800 chrUn 100.000 38 0 0 2 39 400811819 400811856 1.670000e-08 71.3
21 TraesCS3B01G188800 chrUn 100.000 38 0 0 2 39 448650491 448650528 1.670000e-08 71.3
22 TraesCS3B01G188800 chr7B 100.000 39 0 0 2 40 41574198 41574236 4.650000e-09 73.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G188800 chr3B 201555401 201558762 3361 True 6209 6209 100.0000 1 3362 1 chr3B.!!$R1 3361
1 TraesCS3B01G188800 chr3B 703004020 703007085 3065 True 4724 4724 94.3870 26 3119 1 chr3B.!!$R2 3093
2 TraesCS3B01G188800 chr5A 482023990 482027333 3343 True 5919 5919 98.6550 26 3362 1 chr5A.!!$R1 3336
3 TraesCS3B01G188800 chr5B 429038785 429042016 3231 False 5443 5443 97.0440 125 3362 1 chr5B.!!$F2 3237
4 TraesCS3B01G188800 chr5B 413609491 413612620 3129 False 5406 5406 97.8620 26 3152 1 chr5B.!!$F1 3126
5 TraesCS3B01G188800 chr4A 219304626 219307983 3357 True 5411 5411 95.7540 2 3362 1 chr4A.!!$R1 3360
6 TraesCS3B01G188800 chr4A 310764417 310768037 3620 False 2763 3417 96.3295 2 3362 2 chr4A.!!$F1 3360
7 TraesCS3B01G188800 chr2D 33935864 33938683 2819 False 4800 4800 97.5580 26 2818 1 chr2D.!!$F1 2792
8 TraesCS3B01G188800 chr2D 630272340 630274845 2505 False 4287 4287 97.7260 26 2503 1 chr2D.!!$F2 2477
9 TraesCS3B01G188800 chr6D 322234700 322237526 2826 False 4636 4636 96.2980 264 3086 1 chr6D.!!$F1 2822
10 TraesCS3B01G188800 chr1D 254419186 254421438 2252 False 3890 3890 97.8710 409 2655 1 chr1D.!!$F1 2246
11 TraesCS3B01G188800 chr3D 158929682 158930891 1209 False 2080 2080 97.7690 2159 3362 1 chr3D.!!$F1 1203
12 TraesCS3B01G188800 chr3D 158935797 158937006 1209 False 2074 2074 97.6860 2159 3362 1 chr3D.!!$F2 1203
13 TraesCS3B01G188800 chr7A 352674767 352675407 640 True 905 905 91.9450 26 682 1 chr7A.!!$R1 656
14 TraesCS3B01G188800 chrUn 451362690 451363225 535 False 846 846 95.7090 2 520 1 chrUn.!!$F3 518

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
565 605 2.605837 TGTGTACGAGCTTGTCCAAA 57.394 45.000 10.71 0.0 0.00 3.28 F
1270 1316 3.986277 TCTTCGCGAGACCTTTTACTTT 58.014 40.909 9.59 0.0 41.84 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1473 1784 3.806949 AGTATTTCCAAGGTTGCAGGA 57.193 42.857 0.0 0.00 0.0 3.86 R
2734 3066 0.178891 TGAGGCCTGGGGATCCTATC 60.179 60.000 12.0 2.56 0.0 2.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
565 605 2.605837 TGTGTACGAGCTTGTCCAAA 57.394 45.000 10.71 0.0 0.00 3.28
1270 1316 3.986277 TCTTCGCGAGACCTTTTACTTT 58.014 40.909 9.59 0.0 41.84 2.66
1271 1317 4.374399 TCTTCGCGAGACCTTTTACTTTT 58.626 39.130 9.59 0.0 41.84 2.27
1942 2254 7.264947 TGATAGAATGCGTCTTGTTTATCTCA 58.735 34.615 0.00 0.0 37.84 3.27
2734 3066 4.781934 AGTTTCCTTAGGATCCCAATTCG 58.218 43.478 8.55 0.0 0.00 3.34
3096 3447 6.379133 ACATGCATCATTAACCACTGAGATTT 59.621 34.615 0.00 0.0 0.00 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
310 348 7.173907 TGAAGAGAGCCAAGAGACTTTAATTTG 59.826 37.037 0.00 0.00 0.00 2.32
522 562 8.159447 ACATTGAGTGCATCCTATACATGTATT 58.841 33.333 22.90 8.14 0.00 1.89
565 605 8.386264 CCCAGGGTATCATTTCTAATACATCTT 58.614 37.037 0.00 0.00 31.33 2.40
632 672 5.042463 TCTTACAACCCACACAATCTTCA 57.958 39.130 0.00 0.00 0.00 3.02
828 870 6.687081 AAAGACAAGATACGTTTTGACCAA 57.313 33.333 12.27 0.00 0.00 3.67
1473 1784 3.806949 AGTATTTCCAAGGTTGCAGGA 57.193 42.857 0.00 0.00 0.00 3.86
2683 3015 7.040686 GGCATTTATTACTTGGACCATATTCGT 60.041 37.037 0.00 0.00 0.00 3.85
2734 3066 0.178891 TGAGGCCTGGGGATCCTATC 60.179 60.000 12.00 2.56 0.00 2.08
3096 3447 5.061853 CCACGATACTAGTACCTGCTCTAA 58.938 45.833 4.31 0.00 0.00 2.10
3246 3597 1.640149 TGATCTTCCTTTCATGGGCCA 59.360 47.619 9.61 9.61 0.00 5.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.