Multiple sequence alignment - TraesCS3B01G188700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G188700 chr3B 100.000 2597 0 0 1 2597 201554273 201556869 0.000000e+00 4796
1 TraesCS3B01G188700 chr3B 93.653 1229 50 10 1372 2597 703004020 703005223 0.000000e+00 1812
2 TraesCS3B01G188700 chr5A 98.693 2602 27 4 1 2597 482022864 482025463 0.000000e+00 4610
3 TraesCS3B01G188700 chr4A 96.241 2607 81 12 1 2597 219303501 219306100 0.000000e+00 4255
4 TraesCS3B01G188700 chr4A 95.942 2612 81 19 1 2597 310769168 310766567 0.000000e+00 4213
5 TraesCS3B01G188700 chr7B 96.197 2603 87 10 1 2597 105212002 105209406 0.000000e+00 4248
6 TraesCS3B01G188700 chr3D 97.440 2344 44 10 1 2332 158932021 158929682 0.000000e+00 3982
7 TraesCS3B01G188700 chr3D 97.313 2345 45 10 1 2332 158938136 158935797 0.000000e+00 3965
8 TraesCS3B01G188700 chr3D 98.079 2082 30 9 1 2076 589249364 589247287 0.000000e+00 3615
9 TraesCS3B01G188700 chr5D 96.949 1934 45 12 1 1926 432405900 432407827 0.000000e+00 3232
10 TraesCS3B01G188700 chrUn 97.700 1565 24 10 1 1557 371791568 371790008 0.000000e+00 2680
11 TraesCS3B01G188700 chr2B 99.522 209 1 0 2092 2300 110647577 110647369 5.240000e-102 381
12 TraesCS3B01G188700 chr2B 95.652 138 6 0 2416 2553 83488765 83488902 3.360000e-54 222
13 TraesCS3B01G188700 chr2B 96.460 113 4 0 2415 2527 512494469 512494357 1.230000e-43 187
14 TraesCS3B01G188700 chr2B 95.575 113 5 0 2415 2527 511421023 511421135 5.710000e-42 182
15 TraesCS3B01G188700 chr2B 89.744 78 6 2 2235 2311 590872097 590872021 5.910000e-17 99
16 TraesCS3B01G188700 chr7A 93.396 106 6 1 2386 2491 611264868 611264972 3.460000e-34 156
17 TraesCS3B01G188700 chr7A 93.269 104 7 0 1961 2064 521953476 521953579 1.240000e-33 154
18 TraesCS3B01G188700 chr7A 97.333 75 1 1 2037 2111 591508758 591508685 2.710000e-25 126


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G188700 chr3B 201554273 201556869 2596 False 4796.0 4796 100.0000 1 2597 1 chr3B.!!$F1 2596
1 TraesCS3B01G188700 chr3B 703004020 703005223 1203 False 1812.0 1812 93.6530 1372 2597 1 chr3B.!!$F2 1225
2 TraesCS3B01G188700 chr5A 482022864 482025463 2599 False 4610.0 4610 98.6930 1 2597 1 chr5A.!!$F1 2596
3 TraesCS3B01G188700 chr4A 219303501 219306100 2599 False 4255.0 4255 96.2410 1 2597 1 chr4A.!!$F1 2596
4 TraesCS3B01G188700 chr4A 310766567 310769168 2601 True 4213.0 4213 95.9420 1 2597 1 chr4A.!!$R1 2596
5 TraesCS3B01G188700 chr7B 105209406 105212002 2596 True 4248.0 4248 96.1970 1 2597 1 chr7B.!!$R1 2596
6 TraesCS3B01G188700 chr3D 158929682 158938136 8454 True 3973.5 3982 97.3765 1 2332 2 chr3D.!!$R2 2331
7 TraesCS3B01G188700 chr3D 589247287 589249364 2077 True 3615.0 3615 98.0790 1 2076 1 chr3D.!!$R1 2075
8 TraesCS3B01G188700 chr5D 432405900 432407827 1927 False 3232.0 3232 96.9490 1 1926 1 chr5D.!!$F1 1925
9 TraesCS3B01G188700 chrUn 371790008 371791568 1560 True 2680.0 2680 97.7000 1 1557 1 chrUn.!!$R1 1556

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
710 6848 6.70405 GGGCAAAGCAAGAGTTTATTGTAAAA 59.296 34.615 0.0 0.0 0.0 1.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1755 7914 4.781934 AGTTTCCTTAGGATCCCAATTCG 58.218 43.478 8.55 0.0 0.0 3.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
710 6848 6.704050 GGGCAAAGCAAGAGTTTATTGTAAAA 59.296 34.615 0.00 0.00 0.0 1.52
1243 7383 1.640149 TGATCTTCCTTTCATGGGCCA 59.360 47.619 9.61 9.61 0.0 5.36
1393 7534 5.061853 CCACGATACTAGTACCTGCTCTAA 58.938 45.833 4.31 0.00 0.0 2.10
1755 7914 0.178891 TGAGGCCTGGGGATCCTATC 60.179 60.000 12.00 2.56 0.0 2.08
1806 7966 7.040686 GGCATTTATTACTTGGACCATATTCGT 60.041 37.037 0.00 0.00 0.0 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
281 6410 9.158233 GAATACTTAGCACACAGTATACCAAAA 57.842 33.333 0.00 0.0 35.54 2.44
710 6848 7.041235 TCGTTTGGTAGTATCGTTTCCATTTTT 60.041 33.333 0.00 0.0 0.00 1.94
851 6990 3.088532 GTCTACCAATTTCACCATGGCA 58.911 45.455 13.04 0.0 37.77 4.92
1393 7534 6.379133 ACATGCATCATTAACCACTGAGATTT 59.621 34.615 0.00 0.0 0.00 2.17
1755 7914 4.781934 AGTTTCCTTAGGATCCCAATTCG 58.218 43.478 8.55 0.0 0.00 3.34
2547 8726 7.264947 TGATAGAATGCGTCTTGTTTATCTCA 58.735 34.615 0.00 0.0 37.84 3.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.