Multiple sequence alignment - TraesCS3B01G188300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G188300 chr3B 100.000 2240 0 0 1 2240 201542013 201544252 0 4137
1 TraesCS3B01G188300 chr3B 98.306 2243 35 2 1 2240 201572294 201570052 0 3928
2 TraesCS3B01G188300 chr2A 98.707 2243 26 2 1 2240 726903962 726901720 0 3978
3 TraesCS3B01G188300 chr5D 98.306 2243 33 4 1 2240 503247765 503250005 0 3927
4 TraesCS3B01G188300 chr3D 98.261 2243 35 3 1 2240 589261034 589258793 0 3923
5 TraesCS3B01G188300 chr7B 98.127 2242 40 2 1 2240 662729407 662731648 0 3906
6 TraesCS3B01G188300 chr7B 98.127 2242 40 2 1 2240 663096932 663094691 0 3906
7 TraesCS3B01G188300 chr2D 98.082 2242 38 5 1 2240 272809753 272807515 0 3897
8 TraesCS3B01G188300 chr3A 97.904 2242 44 3 1 2240 695642878 695645118 0 3877


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G188300 chr3B 201542013 201544252 2239 False 4137 4137 100.000 1 2240 1 chr3B.!!$F1 2239
1 TraesCS3B01G188300 chr3B 201570052 201572294 2242 True 3928 3928 98.306 1 2240 1 chr3B.!!$R1 2239
2 TraesCS3B01G188300 chr2A 726901720 726903962 2242 True 3978 3978 98.707 1 2240 1 chr2A.!!$R1 2239
3 TraesCS3B01G188300 chr5D 503247765 503250005 2240 False 3927 3927 98.306 1 2240 1 chr5D.!!$F1 2239
4 TraesCS3B01G188300 chr3D 589258793 589261034 2241 True 3923 3923 98.261 1 2240 1 chr3D.!!$R1 2239
5 TraesCS3B01G188300 chr7B 662729407 662731648 2241 False 3906 3906 98.127 1 2240 1 chr7B.!!$F1 2239
6 TraesCS3B01G188300 chr7B 663094691 663096932 2241 True 3906 3906 98.127 1 2240 1 chr7B.!!$R1 2239
7 TraesCS3B01G188300 chr2D 272807515 272809753 2238 True 3897 3897 98.082 1 2240 1 chr2D.!!$R1 2239
8 TraesCS3B01G188300 chr3A 695642878 695645118 2240 False 3877 3877 97.904 1 2240 1 chr3A.!!$F1 2239

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
343 344 0.909623 CCTTGTTGGTACGGAGGGAT 59.09 55.0 0.0 0.0 30.57 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1461 1465 1.830847 GGTGCCAAACCTTCCCGTT 60.831 57.895 0.0 0.0 46.55 4.44 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
173 174 2.069273 CGAAGTGGAAGCGAGAATGTT 58.931 47.619 0.00 0.0 0.00 2.71
207 208 4.216257 ACGAAAACATTGGTGAGAATCCAG 59.784 41.667 0.00 0.0 36.28 3.86
343 344 0.909623 CCTTGTTGGTACGGAGGGAT 59.090 55.000 0.00 0.0 30.57 3.85
485 486 1.153369 GCGCTGAAGTATGAGCCCA 60.153 57.895 0.00 0.0 30.98 5.36
806 808 1.922057 CCATGTATGGGGGCTGACA 59.078 57.895 2.87 0.0 44.31 3.58
946 948 1.219935 GGTAAGTTCCGACCCGCAT 59.780 57.895 0.00 0.0 0.00 4.73
1156 1158 2.101415 CGAGCCATCAGTGAGATACCAA 59.899 50.000 0.00 0.0 34.43 3.67
1374 1377 2.028385 ACGAAAGTCGGCCTTAGTGATT 60.028 45.455 0.00 0.0 45.59 2.57
1393 1396 2.432628 GACGGTGCCGAGTGGAAG 60.433 66.667 18.16 0.0 42.83 3.46
1461 1465 1.630369 CTTCCCCAAGAGTCCACATCA 59.370 52.381 0.00 0.0 0.00 3.07
1571 1575 0.687354 ACGTGAGCTGGGTTCAGAAT 59.313 50.000 0.00 0.0 43.49 2.40
1972 1976 5.121768 CGAACGATTTGAACCTTGTTCCTAT 59.878 40.000 4.65 0.0 33.86 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
158 159 0.036732 AGCCAACATTCTCGCTTCCA 59.963 50.000 0.00 0.00 0.00 3.53
173 174 4.261405 CCAATGTTTTCGTTACTCAAGCCA 60.261 41.667 0.00 0.00 0.00 4.75
207 208 2.570284 CCTTGGGTTTTCGGGGCAC 61.570 63.158 0.00 0.00 0.00 5.01
234 235 0.324943 CCTCCATGGACGAACCTTGT 59.675 55.000 11.44 0.00 40.75 3.16
343 344 3.225608 GCTAACCTAGCCTCCTCCA 57.774 57.895 0.00 0.00 45.95 3.86
612 613 1.430075 TCTACCTACCCACCTGTGTCA 59.570 52.381 0.00 0.00 0.00 3.58
889 891 6.150140 CGCTACCTTAGGACCGTTATAGTTAT 59.850 42.308 4.77 0.00 0.00 1.89
946 948 1.404986 CCCAGATCGTTACGCCTTTCA 60.405 52.381 0.00 0.00 0.00 2.69
1156 1158 2.676748 AGAATCCGAGCTCTTCCAGAT 58.323 47.619 12.85 3.46 0.00 2.90
1461 1465 1.830847 GGTGCCAAACCTTCCCGTT 60.831 57.895 0.00 0.00 46.55 4.44
1889 1893 7.309194 GCACTTCCACTTGACACCTATTTAAAT 60.309 37.037 5.89 5.89 0.00 1.40
2055 2059 1.836166 CAAGAGATGGAAGGGCAGAGA 59.164 52.381 0.00 0.00 0.00 3.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.