Multiple sequence alignment - TraesCS3B01G188000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G188000 chr3B 100.000 2177 0 0 1 2177 201537274 201535098 0 4021
1 TraesCS3B01G188000 chr6D 98.852 2178 24 1 1 2177 389254923 389252746 0 3882
2 TraesCS3B01G188000 chr3A 98.760 2178 25 2 1 2177 66007378 66009554 0 3871
3 TraesCS3B01G188000 chr3A 98.026 2178 42 1 1 2177 672899767 672901944 0 3783
4 TraesCS3B01G188000 chr5D 98.714 2178 26 2 1 2177 503238780 503236604 0 3866
5 TraesCS3B01G188000 chr5D 98.801 2168 24 2 11 2177 503243019 503240853 0 3858
6 TraesCS3B01G188000 chrUn 98.531 2179 27 3 1 2177 216508364 216510539 0 3842
7 TraesCS3B01G188000 chr2A 97.888 2178 45 1 1 2177 335845066 335842889 0 3766
8 TraesCS3B01G188000 chr2B 97.750 2178 48 1 1 2177 474918684 474916507 0 3749
9 TraesCS3B01G188000 chr1B 97.612 2178 45 2 1 2177 633743659 633745830 0 3727


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G188000 chr3B 201535098 201537274 2176 True 4021 4021 100.0000 1 2177 1 chr3B.!!$R1 2176
1 TraesCS3B01G188000 chr6D 389252746 389254923 2177 True 3882 3882 98.8520 1 2177 1 chr6D.!!$R1 2176
2 TraesCS3B01G188000 chr3A 66007378 66009554 2176 False 3871 3871 98.7600 1 2177 1 chr3A.!!$F1 2176
3 TraesCS3B01G188000 chr3A 672899767 672901944 2177 False 3783 3783 98.0260 1 2177 1 chr3A.!!$F2 2176
4 TraesCS3B01G188000 chr5D 503236604 503243019 6415 True 3862 3866 98.7575 1 2177 2 chr5D.!!$R1 2176
5 TraesCS3B01G188000 chrUn 216508364 216510539 2175 False 3842 3842 98.5310 1 2177 1 chrUn.!!$F1 2176
6 TraesCS3B01G188000 chr2A 335842889 335845066 2177 True 3766 3766 97.8880 1 2177 1 chr2A.!!$R1 2176
7 TraesCS3B01G188000 chr2B 474916507 474918684 2177 True 3749 3749 97.7500 1 2177 1 chr2B.!!$R1 2176
8 TraesCS3B01G188000 chr1B 633743659 633745830 2171 False 3727 3727 97.6120 1 2177 1 chr1B.!!$F1 2176

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
127 4367 0.463295 CAGCGTTCATCCTGAGCCAT 60.463 55.0 0.0 0.0 0.0 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2126 6371 3.975312 TCACCCTTACTGTCCCTTTACAA 59.025 43.478 0.0 0.0 0.0 2.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 4293 3.243839 GGTTCTTACGTGTTACTCACCCA 60.244 47.826 0.00 0.00 43.51 4.51
57 4297 4.525487 TCTTACGTGTTACTCACCCATTCT 59.475 41.667 0.00 0.00 43.51 2.40
127 4367 0.463295 CAGCGTTCATCCTGAGCCAT 60.463 55.000 0.00 0.00 0.00 4.40
323 4563 3.117738 CCCACAAGCCTCTTATCCATTCT 60.118 47.826 0.00 0.00 0.00 2.40
394 4634 3.394606 GGGTTTAGGGATAATCAGGCTCA 59.605 47.826 0.00 0.00 0.00 4.26
454 4694 2.979678 GCTGAGTTATATCCCTTCCCCA 59.020 50.000 0.00 0.00 0.00 4.96
547 4787 4.023963 GGGCTTTCTTTCCGCACTATTATC 60.024 45.833 0.00 0.00 0.00 1.75
654 4894 7.066887 TCGCACATGGTTTCATAAAATCTGTAT 59.933 33.333 0.00 0.00 31.33 2.29
724 4964 8.459911 TGTTCAGGATGTTCTATTCGATACTA 57.540 34.615 0.00 0.00 37.40 1.82
908 5149 1.160137 CCACGCCCTTTTCTTGAGAG 58.840 55.000 0.00 0.00 0.00 3.20
1234 5475 4.491409 GCCCCCTTTCTCCTCGGC 62.491 72.222 0.00 0.00 0.00 5.54
1476 5717 9.231297 TGCAATCGATCGGATCATATAGATATA 57.769 33.333 16.41 0.00 37.00 0.86
1576 5817 2.178912 TTTGAAGAGTGCCTAACCGG 57.821 50.000 0.00 0.00 0.00 5.28
1895 6137 7.041712 GGATTGATACCGAGAAAGATTTCTTCC 60.042 40.741 9.11 5.48 46.84 3.46
2126 6371 5.313712 AGGTGAAAATCTCATGTACGGTTT 58.686 37.500 0.00 0.00 36.14 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
127 4367 4.646492 TGAATCTCATGGAGAGTTCGATCA 59.354 41.667 2.13 0.0 42.26 2.92
168 4408 6.032956 TGCTTTGTCTACGAATAAGGAAGA 57.967 37.500 0.00 0.0 0.00 2.87
394 4634 2.158813 ACGTGGTGGAAGTCATCAGTTT 60.159 45.455 0.00 0.0 37.13 2.66
454 4694 5.986135 CGTTAATTCTCTTTCTCGATGGGAT 59.014 40.000 0.00 0.0 0.00 3.85
547 4787 9.248291 CCAATTTTTCCCATTATTTGACTATCG 57.752 33.333 0.00 0.0 0.00 2.92
706 4946 9.656040 TCTCCTACTAGTATCGAATAGAACATC 57.344 37.037 2.33 0.0 0.00 3.06
724 4964 2.725637 GAGTCGGGTTCTTCTCCTACT 58.274 52.381 0.00 0.0 0.00 2.57
908 5149 4.425577 AATTTGTCCTCATGTTTCGAGC 57.574 40.909 0.00 0.0 0.00 5.03
1476 5717 4.431416 TGACCTATGTTGTGTTGAAGGT 57.569 40.909 0.00 0.0 39.99 3.50
1576 5817 4.452455 CGGGTTAATGTGAGCTTATCCATC 59.548 45.833 0.00 0.0 0.00 3.51
1895 6137 9.196552 TGCAGATCAAATCACGTCTTATAATAG 57.803 33.333 0.00 0.0 0.00 1.73
2126 6371 3.975312 TCACCCTTACTGTCCCTTTACAA 59.025 43.478 0.00 0.0 0.00 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.