Multiple sequence alignment - TraesCS3B01G187700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G187700 chr3B 100.000 2372 0 0 1 2372 201523604 201521233 0.000000e+00 4381.0
1 TraesCS3B01G187700 chrUn 98.364 2384 26 7 1 2372 93415407 93417789 0.000000e+00 4174.0
2 TraesCS3B01G187700 chr5D 98.237 2382 30 6 1 2372 560881406 560879027 0.000000e+00 4156.0
3 TraesCS3B01G187700 chr5D 96.872 2142 42 11 1 2140 329123509 329125627 0.000000e+00 3561.0
4 TraesCS3B01G187700 chr2D 97.774 2381 37 11 1 2372 272797300 272799673 0.000000e+00 4089.0
5 TraesCS3B01G187700 chr3A 97.513 2372 43 9 1 2370 672913413 672915770 0.000000e+00 4039.0
6 TraesCS3B01G187700 chr6A 96.883 2374 58 10 1 2372 271186367 271184008 0.000000e+00 3960.0
7 TraesCS3B01G187700 chr4D 95.971 2383 71 13 1 2369 19925393 19923022 0.000000e+00 3845.0
8 TraesCS3B01G187700 chr7B 95.790 2328 55 15 56 2372 559141856 559139561 0.000000e+00 3716.0
9 TraesCS3B01G187700 chr2B 96.897 2224 59 7 1 2221 369624640 369622424 0.000000e+00 3716.0
10 TraesCS3B01G187700 chr2B 87.712 236 20 5 34 267 138129569 138129797 1.400000e-67 267.0
11 TraesCS3B01G187700 chr2B 93.548 62 2 1 1 62 694063950 694063891 9.030000e-15 91.6
12 TraesCS3B01G187700 chr2B 85.714 84 12 0 267 350 138131116 138131199 3.250000e-14 89.8
13 TraesCS3B01G187700 chr1A 98.280 1570 22 3 1 1570 584780038 584778474 0.000000e+00 2745.0
14 TraesCS3B01G187700 chr7A 95.374 1643 61 9 1 1640 352185210 352186840 0.000000e+00 2599.0
15 TraesCS3B01G187700 chr1D 98.331 1258 14 5 1118 2372 144238516 144237263 0.000000e+00 2200.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G187700 chr3B 201521233 201523604 2371 True 4381 4381 100.000 1 2372 1 chr3B.!!$R1 2371
1 TraesCS3B01G187700 chrUn 93415407 93417789 2382 False 4174 4174 98.364 1 2372 1 chrUn.!!$F1 2371
2 TraesCS3B01G187700 chr5D 560879027 560881406 2379 True 4156 4156 98.237 1 2372 1 chr5D.!!$R1 2371
3 TraesCS3B01G187700 chr5D 329123509 329125627 2118 False 3561 3561 96.872 1 2140 1 chr5D.!!$F1 2139
4 TraesCS3B01G187700 chr2D 272797300 272799673 2373 False 4089 4089 97.774 1 2372 1 chr2D.!!$F1 2371
5 TraesCS3B01G187700 chr3A 672913413 672915770 2357 False 4039 4039 97.513 1 2370 1 chr3A.!!$F1 2369
6 TraesCS3B01G187700 chr6A 271184008 271186367 2359 True 3960 3960 96.883 1 2372 1 chr6A.!!$R1 2371
7 TraesCS3B01G187700 chr4D 19923022 19925393 2371 True 3845 3845 95.971 1 2369 1 chr4D.!!$R1 2368
8 TraesCS3B01G187700 chr7B 559139561 559141856 2295 True 3716 3716 95.790 56 2372 1 chr7B.!!$R1 2316
9 TraesCS3B01G187700 chr2B 369622424 369624640 2216 True 3716 3716 96.897 1 2221 1 chr2B.!!$R1 2220
10 TraesCS3B01G187700 chr1A 584778474 584780038 1564 True 2745 2745 98.280 1 1570 1 chr1A.!!$R1 1569
11 TraesCS3B01G187700 chr7A 352185210 352186840 1630 False 2599 2599 95.374 1 1640 1 chr7A.!!$F1 1639
12 TraesCS3B01G187700 chr1D 144237263 144238516 1253 True 2200 2200 98.331 1118 2372 1 chr1D.!!$R1 1254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
457 466 5.738619 TGTCCAGTTTTGCAGTAGAGATA 57.261 39.13 0.0 0.0 0.0 1.98 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1905 1944 4.444536 GCGGGGCGATTACCATATATAAA 58.555 43.478 0.0 0.0 0.0 1.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
457 466 5.738619 TGTCCAGTTTTGCAGTAGAGATA 57.261 39.130 0.00 0.00 0.00 1.98
541 559 9.406113 CATAGAGGAAGAATGAAAGGAAAATCT 57.594 33.333 0.00 0.00 0.00 2.40
546 564 6.423776 AAGAATGAAAGGAAAATCTTGCCA 57.576 33.333 0.00 0.00 0.00 4.92
1325 1354 2.216898 GATTGCCGAGGAATTGAGAGG 58.783 52.381 0.00 0.00 0.00 3.69
1727 1765 8.510505 CATCAAAAGAGAAAGACTAGAAAAGGG 58.489 37.037 0.00 0.00 0.00 3.95
1875 1913 5.988561 GGAATAATGACAGATCGAGAAGCTT 59.011 40.000 0.00 0.00 0.00 3.74
1905 1944 6.394345 ACAGAATTGGGGAGAAGTCTTATT 57.606 37.500 0.00 0.00 27.93 1.40
2222 2275 4.606457 AGTCGTTATGATTCAAGCAAGC 57.394 40.909 0.00 0.00 0.00 4.01
2266 2319 4.315803 CCCATAAGGATTCGAAGCGTATT 58.684 43.478 9.23 5.79 38.24 1.89
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
457 466 6.209788 AGTCGATGGTTCTCTTTCTTAGTTCT 59.790 38.462 0.00 0.00 0.00 3.01
541 559 2.560542 ACAAATACGATTGCCTTGGCAA 59.439 40.909 26.43 26.43 33.52 4.52
546 564 5.208463 ACCAAAACAAATACGATTGCCTT 57.792 34.783 0.00 0.00 33.52 4.35
1616 1653 7.902387 AAAACCCTCTCGTAGAAGTATTTTC 57.098 36.000 0.00 0.00 34.09 2.29
1875 1913 5.073144 ACTTCTCCCCAATTCTGTTTAGTCA 59.927 40.000 0.00 0.00 0.00 3.41
1905 1944 4.444536 GCGGGGCGATTACCATATATAAA 58.555 43.478 0.00 0.00 0.00 1.40
2222 2275 7.596494 TGGGGAAGTCTATAAATTATACGTCG 58.404 38.462 0.00 0.00 0.00 5.12
2266 2319 5.254115 TCTTCACTATCCTTCGAGTCTTCA 58.746 41.667 0.00 0.00 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.