Multiple sequence alignment - TraesCS3B01G187600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G187600 chr3B 100.000 2432 0 0 1 2432 201521858 201519427 0.000000e+00 4492
1 TraesCS3B01G187600 chrUn 98.891 2435 23 4 1 2432 93417164 93419597 0.000000e+00 4344
2 TraesCS3B01G187600 chr1D 98.810 2436 24 5 1 2432 144237890 144235456 0.000000e+00 4333
3 TraesCS3B01G187600 chr5D 98.768 2436 23 7 1 2432 560879652 560877220 0.000000e+00 4325
4 TraesCS3B01G187600 chr5D 98.317 2436 28 8 1 2432 503213086 503210660 0.000000e+00 4259
5 TraesCS3B01G187600 chr6A 97.413 2435 53 10 1 2432 271184630 271182203 0.000000e+00 4139
6 TraesCS3B01G187600 chr6A 96.057 2435 66 11 1 2432 260125620 260128027 0.000000e+00 3938
7 TraesCS3B01G187600 chr1A 96.470 2436 68 13 1 2432 168443440 168445861 0.000000e+00 4006
8 TraesCS3B01G187600 chr7A 92.731 2435 126 20 1 2432 352186897 352189283 0.000000e+00 3469
9 TraesCS3B01G187600 chr7A 97.315 782 13 6 1 781 201367212 201367986 0.000000e+00 1321
10 TraesCS3B01G187600 chr3A 96.777 1955 47 12 1 1950 692572985 692571042 0.000000e+00 3247
11 TraesCS3B01G187600 chr2A 98.400 500 8 0 1927 2426 771308037 771308536 0.000000e+00 880
12 TraesCS3B01G187600 chr2B 98.742 159 2 0 2274 2432 482477608 482477766 1.420000e-72 283


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G187600 chr3B 201519427 201521858 2431 True 4492 4492 100.000 1 2432 1 chr3B.!!$R1 2431
1 TraesCS3B01G187600 chrUn 93417164 93419597 2433 False 4344 4344 98.891 1 2432 1 chrUn.!!$F1 2431
2 TraesCS3B01G187600 chr1D 144235456 144237890 2434 True 4333 4333 98.810 1 2432 1 chr1D.!!$R1 2431
3 TraesCS3B01G187600 chr5D 560877220 560879652 2432 True 4325 4325 98.768 1 2432 1 chr5D.!!$R2 2431
4 TraesCS3B01G187600 chr5D 503210660 503213086 2426 True 4259 4259 98.317 1 2432 1 chr5D.!!$R1 2431
5 TraesCS3B01G187600 chr6A 271182203 271184630 2427 True 4139 4139 97.413 1 2432 1 chr6A.!!$R1 2431
6 TraesCS3B01G187600 chr6A 260125620 260128027 2407 False 3938 3938 96.057 1 2432 1 chr6A.!!$F1 2431
7 TraesCS3B01G187600 chr1A 168443440 168445861 2421 False 4006 4006 96.470 1 2432 1 chr1A.!!$F1 2431
8 TraesCS3B01G187600 chr7A 352186897 352189283 2386 False 3469 3469 92.731 1 2432 1 chr7A.!!$F2 2431
9 TraesCS3B01G187600 chr7A 201367212 201367986 774 False 1321 1321 97.315 1 781 1 chr7A.!!$F1 780
10 TraesCS3B01G187600 chr3A 692571042 692572985 1943 True 3247 3247 96.777 1 1950 1 chr3A.!!$R1 1949

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
781 794 4.25985 GCGTGGACGAATTAGAGTCATTTC 60.26 45.833 2.73 0.0 43.02 2.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2132 2151 4.302559 AAAGTGCTTCCTTAGGGGTTAG 57.697 45.455 0.0 0.0 36.25 2.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
129 130 5.988561 GGAATAATGACAGATCGAGAAGCTT 59.011 40.000 0.00 0.00 0.00 3.74
476 478 4.606457 AGTCGTTATGATTCAAGCAAGC 57.394 40.909 0.00 0.00 0.00 4.01
520 522 4.315803 CCCATAAGGATTCGAAGCGTATT 58.684 43.478 9.23 5.79 38.24 1.89
538 540 5.505985 GCGTATTGAAGACTCGAAGGATAGT 60.506 44.000 0.00 0.00 0.00 2.12
600 602 9.987272 CAAAGATTCAAAGGATTAGGTTTTTCT 57.013 29.630 0.00 0.00 0.00 2.52
655 662 8.240883 TCTAAAATTCAAGCGAAGAGACTTAC 57.759 34.615 0.00 0.00 33.74 2.34
781 794 4.259850 GCGTGGACGAATTAGAGTCATTTC 60.260 45.833 2.73 0.00 43.02 2.17
1167 1185 1.202770 ACTGTTACAGACCCACAAGGC 60.203 52.381 20.07 0.00 35.17 4.35
1231 1249 1.888512 GCTCAAGAAAAGCATCACCCA 59.111 47.619 0.00 0.00 39.61 4.51
1655 1673 0.390603 CACCGTCGGTATTGCCTTGA 60.391 55.000 18.38 0.00 32.11 3.02
2095 2113 5.994250 TGTGGGAATGGAAATGAAAAACAA 58.006 33.333 0.00 0.00 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
129 130 5.073144 ACTTCTCCCCAATTCTGTTTAGTCA 59.927 40.000 0.0 0.0 0.00 3.41
285 287 2.742589 GTTACTTTTGCTTCTCTCGGGG 59.257 50.000 0.0 0.0 0.00 5.73
476 478 7.596494 TGGGGAAGTCTATAAATTATACGTCG 58.404 38.462 0.0 0.0 0.00 5.12
520 522 5.254115 TCTTCACTATCCTTCGAGTCTTCA 58.746 41.667 0.0 0.0 0.00 3.02
538 540 5.977635 TCTTCGCTATCCTTCAAATCTTCA 58.022 37.500 0.0 0.0 0.00 3.02
781 794 6.538742 TCTTTGTTTATGCTTCGGATTAGAGG 59.461 38.462 0.0 0.0 0.00 3.69
1267 1285 1.508632 GCTCGTTGCAAACCTACTGA 58.491 50.000 0.0 0.0 46.28 3.41
1655 1673 8.140112 TCTATTTCTCCAAGTAAAGCTCTTCT 57.860 34.615 0.0 0.0 0.00 2.85
2132 2151 4.302559 AAAGTGCTTCCTTAGGGGTTAG 57.697 45.455 0.0 0.0 36.25 2.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.