Multiple sequence alignment - TraesCS3B01G187300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G187300 chr3B 100.000 2651 0 0 1 2651 201512837 201510187 0 4896
1 TraesCS3B01G187300 chr5D 99.057 2652 24 1 1 2651 240137415 240134764 0 4758
2 TraesCS3B01G187300 chr5D 98.190 2652 41 6 1 2651 6201570 6204215 0 4625
3 TraesCS3B01G187300 chr1D 98.152 2651 34 6 1 2651 254497706 254495071 0 4610
4 TraesCS3B01G187300 chr1D 98.208 2344 28 2 309 2651 483915214 483917544 0 4084
5 TraesCS3B01G187300 chr1D 97.543 1628 20 3 1 1610 19957742 19956117 0 2767
6 TraesCS3B01G187300 chr4D 96.532 2653 86 5 1 2651 19916206 19913558 0 4385
7 TraesCS3B01G187300 chr3D 98.486 2311 32 3 1 2310 21904334 21902026 0 4071
8 TraesCS3B01G187300 chr3D 98.988 889 7 2 1764 2651 21902036 21901149 0 1591
9 TraesCS3B01G187300 chr6B 97.811 1782 38 1 1 1782 22425653 22423873 0 3073
10 TraesCS3B01G187300 chr2D 98.088 1569 25 4 1085 2651 334231119 334229554 0 2726
11 TraesCS3B01G187300 chr1A 98.503 1336 17 2 1 1334 112776324 112777658 0 2353
12 TraesCS3B01G187300 chr2B 98.632 1316 15 3 1334 2648 474897223 474898536 0 2327
13 TraesCS3B01G187300 chr7A 96.930 847 26 0 1 847 352202402 352203248 0 1421


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G187300 chr3B 201510187 201512837 2650 True 4896 4896 100.000 1 2651 1 chr3B.!!$R1 2650
1 TraesCS3B01G187300 chr5D 240134764 240137415 2651 True 4758 4758 99.057 1 2651 1 chr5D.!!$R1 2650
2 TraesCS3B01G187300 chr5D 6201570 6204215 2645 False 4625 4625 98.190 1 2651 1 chr5D.!!$F1 2650
3 TraesCS3B01G187300 chr1D 254495071 254497706 2635 True 4610 4610 98.152 1 2651 1 chr1D.!!$R2 2650
4 TraesCS3B01G187300 chr1D 483915214 483917544 2330 False 4084 4084 98.208 309 2651 1 chr1D.!!$F1 2342
5 TraesCS3B01G187300 chr1D 19956117 19957742 1625 True 2767 2767 97.543 1 1610 1 chr1D.!!$R1 1609
6 TraesCS3B01G187300 chr4D 19913558 19916206 2648 True 4385 4385 96.532 1 2651 1 chr4D.!!$R1 2650
7 TraesCS3B01G187300 chr3D 21901149 21904334 3185 True 2831 4071 98.737 1 2651 2 chr3D.!!$R1 2650
8 TraesCS3B01G187300 chr6B 22423873 22425653 1780 True 3073 3073 97.811 1 1782 1 chr6B.!!$R1 1781
9 TraesCS3B01G187300 chr2D 334229554 334231119 1565 True 2726 2726 98.088 1085 2651 1 chr2D.!!$R1 1566
10 TraesCS3B01G187300 chr1A 112776324 112777658 1334 False 2353 2353 98.503 1 1334 1 chr1A.!!$F1 1333
11 TraesCS3B01G187300 chr2B 474897223 474898536 1313 False 2327 2327 98.632 1334 2648 1 chr2B.!!$F1 1314
12 TraesCS3B01G187300 chr7A 352202402 352203248 846 False 1421 1421 96.930 1 847 1 chr7A.!!$F1 846

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
73 74 2.999063 GCAAGCCACCCCTGCAAT 60.999 61.111 0.0 0.0 0.0 3.56 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1880 2442 1.414181 CCCTAGCACATGTTCCTCGAT 59.586 52.381 0.0 0.0 0.0 3.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 2.999063 GCAAGCCACCCCTGCAAT 60.999 61.111 0.00 0.00 0.00 3.56
103 104 4.355549 TGAATTCCAAAGATCTTGGGCAT 58.644 39.130 22.59 15.49 39.96 4.40
386 388 5.190528 AGAGGGATCAGAAACTGCTAATTCA 59.809 40.000 0.00 0.00 0.00 2.57
460 462 3.118454 CGCAAGCAATCGACCCGT 61.118 61.111 0.00 0.00 0.00 5.28
714 718 9.899661 AGATCTATTCTATACTCGATAAGTGCT 57.100 33.333 0.00 0.00 34.35 4.40
1031 1035 4.079901 TGGTGTTCCAAAAGTACCTTACCA 60.080 41.667 0.00 0.00 41.25 3.25
1123 1127 2.839486 AGGTCAAGAGATTCGTTGCA 57.161 45.000 0.00 0.00 0.00 4.08
1452 1476 6.803642 AGTAGAAGAGTTACACAAAGTTCGT 58.196 36.000 0.00 0.00 0.00 3.85
1629 1653 1.270839 ACTGATCCAGTGTGGTTTCCG 60.271 52.381 0.00 0.00 43.63 4.30
2327 2890 4.525874 CCTTTTGATGAAAGAAAGGGCTCT 59.474 41.667 6.27 0.00 46.24 4.09
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
103 104 2.645797 ACGGGAAAACCCTCTTTGGATA 59.354 45.455 0.00 0.00 38.35 2.59
372 374 9.971922 AATGGCTTTATATGAATTAGCAGTTTC 57.028 29.630 0.00 0.00 33.60 2.78
386 388 3.160269 GGCTGGCTCAATGGCTTTATAT 58.840 45.455 0.00 0.00 42.34 0.86
460 462 7.062956 GTGTTCACACTGTCGTATTGAATGATA 59.937 37.037 2.65 0.00 43.25 2.15
479 481 1.803334 TGCCTTGGTATCGTGTTCAC 58.197 50.000 0.00 0.00 0.00 3.18
714 718 3.194542 GCCAAGTTACCCATTGCACATTA 59.805 43.478 0.00 0.00 0.00 1.90
718 722 0.246360 GGCCAAGTTACCCATTGCAC 59.754 55.000 0.00 0.00 0.00 4.57
1031 1035 3.181467 CGCTTCTTCATCTCCAGGAATCT 60.181 47.826 0.00 0.00 0.00 2.40
1123 1127 7.957002 AGACCTGTAATATGATTCGTGATCTT 58.043 34.615 0.00 0.97 35.69 2.40
1452 1476 5.479724 TGCATAAACCCTTGTGATCATTTCA 59.520 36.000 0.00 0.00 0.00 2.69
1629 1653 7.362660 GGACACTACCAATCCTTAAACATTTCC 60.363 40.741 0.00 0.00 0.00 3.13
1855 2417 2.112815 GGCATCCTTTAAGCGCGGT 61.113 57.895 4.23 4.23 0.00 5.68
1880 2442 1.414181 CCCTAGCACATGTTCCTCGAT 59.586 52.381 0.00 0.00 0.00 3.59
2327 2890 1.573857 TGAGGCCCTCTCTATACACCA 59.426 52.381 12.94 0.00 42.86 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.