Multiple sequence alignment - TraesCS3B01G187200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G187200 chr3B 100.000 2360 0 0 1 2360 201511238 201508879 0.000000e+00 4359
1 TraesCS3B01G187200 chr3B 87.459 303 23 4 2044 2346 252673882 252674169 3.760000e-88 335
2 TraesCS3B01G187200 chr3B 97.386 153 4 0 1915 2067 820706436 820706588 6.470000e-66 261
3 TraesCS3B01G187200 chr5D 98.899 2362 24 2 1 2360 240135816 240133455 0.000000e+00 4217
4 TraesCS3B01G187200 chr5D 97.841 2362 43 8 1 2360 6203166 6205521 0.000000e+00 4072
5 TraesCS3B01G187200 chr5D 98.488 2116 28 4 246 2360 449151290 449153402 0.000000e+00 3727
6 TraesCS3B01G187200 chr1D 98.688 2362 29 2 1 2360 483916492 483918853 0.000000e+00 4189
7 TraesCS3B01G187200 chr1D 98.645 2361 26 5 1 2360 254496118 254493763 0.000000e+00 4178
8 TraesCS3B01G187200 chr2D 96.653 2390 47 6 1 2360 334230604 334228218 0.000000e+00 3940
9 TraesCS3B01G187200 chr3D 98.544 2198 29 3 165 2360 21902036 21899840 0.000000e+00 3879
10 TraesCS3B01G187200 chr4D 96.357 2361 71 8 1 2360 19914608 19912262 0.000000e+00 3869
11 TraesCS3B01G187200 chr2B 98.761 1291 15 1 530 1819 474898529 474899819 0.000000e+00 2294
12 TraesCS3B01G187200 chr2B 98.667 1050 11 3 1 1049 474897489 474898536 0.000000e+00 1858
13 TraesCS3B01G187200 chr2B 97.656 384 9 0 1905 2288 616581015 616580632 0.000000e+00 660
14 TraesCS3B01G187200 chr2B 98.276 58 1 0 2253 2310 110647708 110647651 4.150000e-18 102
15 TraesCS3B01G187200 chr2A 96.148 623 15 2 1738 2360 42773056 42773669 0.000000e+00 1009


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G187200 chr3B 201508879 201511238 2359 True 4359 4359 100.000 1 2360 1 chr3B.!!$R1 2359
1 TraesCS3B01G187200 chr5D 240133455 240135816 2361 True 4217 4217 98.899 1 2360 1 chr5D.!!$R1 2359
2 TraesCS3B01G187200 chr5D 6203166 6205521 2355 False 4072 4072 97.841 1 2360 1 chr5D.!!$F1 2359
3 TraesCS3B01G187200 chr5D 449151290 449153402 2112 False 3727 3727 98.488 246 2360 1 chr5D.!!$F2 2114
4 TraesCS3B01G187200 chr1D 483916492 483918853 2361 False 4189 4189 98.688 1 2360 1 chr1D.!!$F1 2359
5 TraesCS3B01G187200 chr1D 254493763 254496118 2355 True 4178 4178 98.645 1 2360 1 chr1D.!!$R1 2359
6 TraesCS3B01G187200 chr2D 334228218 334230604 2386 True 3940 3940 96.653 1 2360 1 chr2D.!!$R1 2359
7 TraesCS3B01G187200 chr3D 21899840 21902036 2196 True 3879 3879 98.544 165 2360 1 chr3D.!!$R1 2195
8 TraesCS3B01G187200 chr4D 19912262 19914608 2346 True 3869 3869 96.357 1 2360 1 chr4D.!!$R1 2359
9 TraesCS3B01G187200 chr2B 474897489 474899819 2330 False 2076 2294 98.714 1 1819 2 chr2B.!!$F1 1818
10 TraesCS3B01G187200 chr2A 42773056 42773669 613 False 1009 1009 96.148 1738 2360 1 chr2A.!!$F1 622

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
30 31 1.270839 ACTGATCCAGTGTGGTTTCCG 60.271 52.381 0.0 0.0 43.63 4.3 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1872 2391 0.683412 AACCTTTTCGTAGGCGTCCT 59.317 50.0 3.87 3.87 38.99 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
30 31 1.270839 ACTGATCCAGTGTGGTTTCCG 60.271 52.381 0.00 0.0 43.63 4.30
728 731 4.525874 CCTTTTGATGAAAGAAAGGGCTCT 59.474 41.667 6.27 0.0 46.24 4.09
1269 1787 7.027778 ACACAACCTGTACAAGAAGAAATTC 57.972 36.000 0.00 0.0 0.00 2.17
1531 2049 9.060547 CGAATTCGAATAAAACATCAACAATCA 57.939 29.630 23.29 0.0 43.02 2.57
1588 2106 5.642686 TGGTTGTTGTTTCTTAAGTTTCGG 58.357 37.500 1.63 0.0 0.00 4.30
1972 2491 9.448438 GAAAGGGTTGCTTGGATTTATTAAAAT 57.552 29.630 0.00 0.0 38.03 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
30 31 7.362660 GGACACTACCAATCCTTAAACATTTCC 60.363 40.741 0.00 0.00 0.00 3.13
256 258 2.112815 GGCATCCTTTAAGCGCGGT 61.113 57.895 4.23 4.23 0.00 5.68
281 283 1.414181 CCCTAGCACATGTTCCTCGAT 59.586 52.381 0.00 0.00 0.00 3.59
728 731 1.573857 TGAGGCCCTCTCTATACACCA 59.426 52.381 12.94 0.00 42.86 4.17
1269 1787 7.273164 TGTGCAAGCATTTTACGATTAAGAATG 59.727 33.333 0.00 0.00 0.00 2.67
1588 2106 7.631915 ATTAACGCAAAAGTACAATTCCAAC 57.368 32.000 0.00 0.00 0.00 3.77
1872 2391 0.683412 AACCTTTTCGTAGGCGTCCT 59.317 50.000 3.87 3.87 38.99 3.85
1972 2491 6.987403 ACCCTTTAGTAAATCCAAGCAAAA 57.013 33.333 0.00 0.00 0.00 2.44


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.