Multiple sequence alignment - TraesCS3B01G187100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G187100 chr3B 100.000 2201 0 0 1 2201 201507735 201509935 0.000000e+00 4065
1 TraesCS3B01G187100 chr3B 96.809 188 5 1 264 451 386605063 386604877 1.640000e-81 313
2 TraesCS3B01G187100 chr3B 91.824 159 5 4 440 598 530853335 530853185 4.760000e-52 215
3 TraesCS3B01G187100 chr5D 97.685 2203 46 5 1 2201 6206666 6204467 0.000000e+00 3781
4 TraesCS3B01G187100 chr5D 98.392 2052 30 3 153 2201 240132461 240134512 0.000000e+00 3603
5 TraesCS3B01G187100 chr5D 98.175 1589 27 2 614 2201 449153933 449152346 0.000000e+00 2772
6 TraesCS3B01G187100 chr3D 97.548 2202 36 2 1 2201 21898713 21900897 0.000000e+00 3751
7 TraesCS3B01G187100 chr2D 96.057 2232 55 6 1 2201 334227073 334229302 0.000000e+00 3603
8 TraesCS3B01G187100 chr4D 95.958 2202 56 9 1 2201 19911137 19913306 0.000000e+00 3542
9 TraesCS3B01G187100 chr4D 98.404 188 3 0 42 229 468536288 468536475 4.530000e-87 331
10 TraesCS3B01G187100 chr1D 98.106 1795 29 5 124 1915 254490942 254492734 0.000000e+00 3121
11 TraesCS3B01G187100 chr1D 98.287 1693 28 1 1 1692 483921801 483920109 0.000000e+00 2964
12 TraesCS3B01G187100 chr1D 98.157 1411 23 2 794 2201 483919206 483917796 0.000000e+00 2459
13 TraesCS3B01G187100 chr1D 98.520 1149 15 2 1054 2201 254493672 254494819 0.000000e+00 2026
14 TraesCS3B01G187100 chr1D 98.952 954 9 1 1220 2172 254493682 254492729 0.000000e+00 1705
15 TraesCS3B01G187100 chrUn 98.327 1554 25 1 1 1553 317472029 317470476 0.000000e+00 2724
16 TraesCS3B01G187100 chr2A 97.323 1046 27 1 149 1194 588083919 588084963 0.000000e+00 1775
17 TraesCS3B01G187100 chr2A 96.212 660 8 1 1 660 335827438 335828080 0.000000e+00 1064
18 TraesCS3B01G187100 chr2B 92.977 299 4 1 1 299 759338828 759338547 9.400000e-114 420
19 TraesCS3B01G187100 chr6B 97.727 176 4 0 1 176 276897524 276897349 9.870000e-79 303
20 TraesCS3B01G187100 chr1A 98.726 157 2 0 32 188 548024419 548024263 1.660000e-71 279


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G187100 chr3B 201507735 201509935 2200 False 4065.0 4065 100.000 1 2201 1 chr3B.!!$F1 2200
1 TraesCS3B01G187100 chr5D 6204467 6206666 2199 True 3781.0 3781 97.685 1 2201 1 chr5D.!!$R1 2200
2 TraesCS3B01G187100 chr5D 240132461 240134512 2051 False 3603.0 3603 98.392 153 2201 1 chr5D.!!$F1 2048
3 TraesCS3B01G187100 chr5D 449152346 449153933 1587 True 2772.0 2772 98.175 614 2201 1 chr5D.!!$R2 1587
4 TraesCS3B01G187100 chr3D 21898713 21900897 2184 False 3751.0 3751 97.548 1 2201 1 chr3D.!!$F1 2200
5 TraesCS3B01G187100 chr2D 334227073 334229302 2229 False 3603.0 3603 96.057 1 2201 1 chr2D.!!$F1 2200
6 TraesCS3B01G187100 chr4D 19911137 19913306 2169 False 3542.0 3542 95.958 1 2201 1 chr4D.!!$F1 2200
7 TraesCS3B01G187100 chr1D 483917796 483921801 4005 True 2711.5 2964 98.222 1 2201 2 chr1D.!!$R2 2200
8 TraesCS3B01G187100 chr1D 254490942 254494819 3877 False 2573.5 3121 98.313 124 2201 2 chr1D.!!$F1 2077
9 TraesCS3B01G187100 chr1D 254492729 254493682 953 True 1705.0 1705 98.952 1220 2172 1 chr1D.!!$R1 952
10 TraesCS3B01G187100 chrUn 317470476 317472029 1553 True 2724.0 2724 98.327 1 1553 1 chrUn.!!$R1 1552
11 TraesCS3B01G187100 chr2A 588083919 588084963 1044 False 1775.0 1775 97.323 149 1194 1 chr2A.!!$F2 1045
12 TraesCS3B01G187100 chr2A 335827438 335828080 642 False 1064.0 1064 96.212 1 660 1 chr2A.!!$F1 659

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
71 72 0.652592 CTGCGCTACATCCCTTTTCG 59.347 55.00 9.73 0.0 0.0 3.46 F
499 500 5.499004 ACTCTATGGTTTGGTGCTTTAGA 57.501 39.13 0.00 0.0 0.0 2.10 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1058 2869 3.056607 CGATTCCTCATTGGCACCTTTTT 60.057 43.478 0.00 0.0 35.26 1.94 R
1915 5554 5.642686 TGGTTGTTGTTTCTTAAGTTTCGG 58.357 37.500 1.63 0.0 0.00 4.30 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
71 72 0.652592 CTGCGCTACATCCCTTTTCG 59.347 55.000 9.73 0.00 0.00 3.46
499 500 5.499004 ACTCTATGGTTTGGTGCTTTAGA 57.501 39.130 0.00 0.00 0.00 2.10
766 772 6.097412 CCAAGCTAAATAAGGCCTCAGAAATT 59.903 38.462 5.23 0.00 0.00 1.82
834 840 6.976088 TCGAACCAAAATCTTTGCTAATTCA 58.024 32.000 0.00 0.00 0.00 2.57
946 954 9.713740 CTTCTTCGGATTCAAAATAGAAGAATG 57.286 33.333 20.66 15.21 46.66 2.67
1098 2909 5.388408 AATCGACGGGGATTTCTAGATAC 57.612 43.478 0.00 0.00 32.89 2.24
1531 5168 6.987403 ACCCTTTAGTAAATCCAAGCAAAA 57.013 33.333 0.00 0.00 0.00 2.44
1915 5554 7.631915 ATTAACGCAAAAGTACAATTCCAAC 57.368 32.000 0.00 0.00 0.00 3.77
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
257 258 8.630917 GGAAAAGTAATCCTTCTTTTATAGGCC 58.369 37.037 0.00 0.0 41.79 5.19
578 582 8.091449 GTCATATCACGAAGAAATCTATCCCTT 58.909 37.037 0.00 0.0 0.00 3.95
649 655 5.245977 TCAACCCAATCCATCTTTTCTTTCC 59.754 40.000 0.00 0.0 0.00 3.13
766 772 1.416401 CCCCGCCTTTTCTATGCTCTA 59.584 52.381 0.00 0.0 0.00 2.43
1043 2854 5.410067 CACCTTTTTGAACACAACTGATGT 58.590 37.500 0.00 0.0 45.34 3.06
1058 2869 3.056607 CGATTCCTCATTGGCACCTTTTT 60.057 43.478 0.00 0.0 35.26 1.94
1098 2909 3.745975 TGTGGCGATTCTTTTGAGTACTG 59.254 43.478 0.00 0.0 0.00 2.74
1531 5168 9.448438 GAAAGGGTTGCTTGGATTTATTAAAAT 57.552 29.630 0.00 0.0 38.03 1.82
1915 5554 5.642686 TGGTTGTTGTTTCTTAAGTTTCGG 58.357 37.500 1.63 0.0 0.00 4.30
1972 5611 9.060547 CGAATTCGAATAAAACATCAACAATCA 57.939 29.630 23.29 0.0 43.02 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.