Multiple sequence alignment - TraesCS3B01G187000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G187000 chr3B 100.000 2114 0 0 1 2114 201506282 201508395 0.000000e+00 3904
1 TraesCS3B01G187000 chr3B 96.809 188 5 1 1717 1904 386605063 386604877 1.570000e-81 313
2 TraesCS3B01G187000 chr3B 91.824 159 5 4 1893 2051 530853335 530853185 4.570000e-52 215
3 TraesCS3B01G187000 chr1D 97.975 2123 34 5 1 2114 394178613 394180735 0.000000e+00 3674
4 TraesCS3B01G187000 chr1D 95.124 2051 82 9 70 2114 244443826 244445864 0.000000e+00 3217
5 TraesCS3B01G187000 chr1D 98.418 1454 21 2 662 2114 483922592 483921140 0.000000e+00 2556
6 TraesCS3B01G187000 chr6D 97.826 2116 40 5 1 2114 431399733 431401844 0.000000e+00 3648
7 TraesCS3B01G187000 chrUn 97.643 2121 42 6 1 2114 317473487 317471368 0.000000e+00 3633
8 TraesCS3B01G187000 chrUn 98.653 1188 10 4 1 1182 404957937 404959124 0.000000e+00 2100
9 TraesCS3B01G187000 chrUn 98.423 761 9 2 39 798 53261896 53261138 0.000000e+00 1336
10 TraesCS3B01G187000 chr2D 97.210 2115 48 8 1 2114 334225628 334227732 0.000000e+00 3568
11 TraesCS3B01G187000 chr5D 97.116 2115 52 5 1 2114 6208111 6206005 0.000000e+00 3559
12 TraesCS3B01G187000 chr5D 98.733 1342 12 4 775 2114 554200522 554199184 0.000000e+00 2379
13 TraesCS3B01G187000 chr2A 97.120 2118 37 6 1 2113 335825982 335828080 0.000000e+00 3552
14 TraesCS3B01G187000 chr1A 98.069 777 12 3 1 775 256026464 256025689 0.000000e+00 1349
15 TraesCS3B01G187000 chr7D 95.238 840 37 2 1 840 88605292 88606128 0.000000e+00 1327
16 TraesCS3B01G187000 chr5A 97.637 677 15 1 1 676 684325291 684325967 0.000000e+00 1160
17 TraesCS3B01G187000 chr4A 96.356 686 17 6 1 684 677310050 677309371 0.000000e+00 1122


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G187000 chr3B 201506282 201508395 2113 False 3904 3904 100.000 1 2114 1 chr3B.!!$F1 2113
1 TraesCS3B01G187000 chr1D 394178613 394180735 2122 False 3674 3674 97.975 1 2114 1 chr1D.!!$F2 2113
2 TraesCS3B01G187000 chr1D 244443826 244445864 2038 False 3217 3217 95.124 70 2114 1 chr1D.!!$F1 2044
3 TraesCS3B01G187000 chr1D 483921140 483922592 1452 True 2556 2556 98.418 662 2114 1 chr1D.!!$R1 1452
4 TraesCS3B01G187000 chr6D 431399733 431401844 2111 False 3648 3648 97.826 1 2114 1 chr6D.!!$F1 2113
5 TraesCS3B01G187000 chrUn 317471368 317473487 2119 True 3633 3633 97.643 1 2114 1 chrUn.!!$R2 2113
6 TraesCS3B01G187000 chrUn 404957937 404959124 1187 False 2100 2100 98.653 1 1182 1 chrUn.!!$F1 1181
7 TraesCS3B01G187000 chrUn 53261138 53261896 758 True 1336 1336 98.423 39 798 1 chrUn.!!$R1 759
8 TraesCS3B01G187000 chr2D 334225628 334227732 2104 False 3568 3568 97.210 1 2114 1 chr2D.!!$F1 2113
9 TraesCS3B01G187000 chr5D 6206005 6208111 2106 True 3559 3559 97.116 1 2114 1 chr5D.!!$R1 2113
10 TraesCS3B01G187000 chr5D 554199184 554200522 1338 True 2379 2379 98.733 775 2114 1 chr5D.!!$R2 1339
11 TraesCS3B01G187000 chr2A 335825982 335828080 2098 False 3552 3552 97.120 1 2113 1 chr2A.!!$F1 2112
12 TraesCS3B01G187000 chr1A 256025689 256026464 775 True 1349 1349 98.069 1 775 1 chr1A.!!$R1 774
13 TraesCS3B01G187000 chr7D 88605292 88606128 836 False 1327 1327 95.238 1 840 1 chr7D.!!$F1 839
14 TraesCS3B01G187000 chr5A 684325291 684325967 676 False 1160 1160 97.637 1 676 1 chr5A.!!$F1 675
15 TraesCS3B01G187000 chr4A 677309371 677310050 679 True 1122 1122 96.356 1 684 1 chr4A.!!$R1 683

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
84 85 5.067954 GGCCTAACTTTCTTGACCAAACTA 58.932 41.667 0.0 0.0 0.00 2.24 F
546 557 6.957920 TTCCACAACAAATCTCTTGATTCA 57.042 33.333 0.0 0.0 41.62 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1088 1111 4.263572 CCAACTGACCCCCACGCA 62.264 66.667 0.0 0.0 0.00 5.24 R
1710 1753 8.630917 GGAAAAGTAATCCTTCTTTTATAGGCC 58.369 37.037 0.0 0.0 41.79 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
63 64 6.071616 TCCTTGTATTGTTTGTTGGATTAGGC 60.072 38.462 0.00 0.00 0.00 3.93
84 85 5.067954 GGCCTAACTTTCTTGACCAAACTA 58.932 41.667 0.00 0.00 0.00 2.24
546 557 6.957920 TTCCACAACAAATCTCTTGATTCA 57.042 33.333 0.00 0.00 41.62 2.57
810 832 9.679661 TCTATTTATTGGCTTGAACAAGATACA 57.320 29.630 17.19 9.87 40.79 2.29
1035 1058 8.943002 GTTTTTCTATTTGGAATCGTCTTAGGA 58.057 33.333 0.00 0.00 0.00 2.94
1088 1111 4.494035 CGTGACTGCGTATTTGCAATACAT 60.494 41.667 0.00 0.00 45.74 2.29
1097 1120 3.119193 GCAATACATGCGTGGGGG 58.881 61.111 11.36 0.00 46.87 5.40
1281 1307 2.114411 GGGTTTTGGAGACCCGCA 59.886 61.111 0.00 0.00 46.71 5.69
1419 1445 6.331061 ACTTTAATTGATCTCGTCGCTACTT 58.669 36.000 0.00 0.00 0.00 2.24
1524 1550 0.652592 CTGCGCTACATCCCTTTTCG 59.347 55.000 9.73 0.00 0.00 3.46
1952 1996 5.499004 ACTCTATGGTTTGGTGCTTTAGA 57.501 39.130 0.00 0.00 0.00 2.10
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
63 64 5.987347 TCGTAGTTTGGTCAAGAAAGTTAGG 59.013 40.000 0.00 0.0 0.00 2.69
84 85 2.084681 CGTAAAGTTCCGCGCTCGT 61.085 57.895 5.56 0.0 0.00 4.18
546 557 7.732140 TCAGATGATACATGAGTCCCTAATTCT 59.268 37.037 0.00 0.0 0.00 2.40
1035 1058 7.607615 TCCCGCTAAAGTAATAGGAATTAGT 57.392 36.000 0.00 0.0 33.46 2.24
1088 1111 4.263572 CCAACTGACCCCCACGCA 62.264 66.667 0.00 0.0 0.00 5.24
1097 1120 5.702670 TGACTCAATCAAAGATCCAACTGAC 59.297 40.000 0.00 0.0 33.02 3.51
1281 1307 5.652518 GCTCTTAGTTCAGTTCGGTAGAAT 58.347 41.667 0.00 0.0 38.80 2.40
1710 1753 8.630917 GGAAAAGTAATCCTTCTTTTATAGGCC 58.369 37.037 0.00 0.0 41.79 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.