Multiple sequence alignment - TraesCS3B01G186900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G186900 chr3B 100.000 2096 0 0 1 2096 201506007 201508102 0.000000e+00 3871
1 TraesCS3B01G186900 chr1D 97.621 2102 34 6 1 2093 394178344 394180438 0.000000e+00 3591
2 TraesCS3B01G186900 chr1D 94.986 1755 72 8 345 2093 244443826 244445570 0.000000e+00 2739
3 TraesCS3B01G186900 chr1D 98.621 1160 15 1 937 2096 483922592 483921434 0.000000e+00 2052
4 TraesCS3B01G186900 chr6D 97.520 2097 40 5 1 2096 431399465 431401550 0.000000e+00 3574
5 TraesCS3B01G186900 chrUn 97.383 2102 41 6 1 2096 317473755 317471662 0.000000e+00 3565
6 TraesCS3B01G186900 chrUn 98.774 1387 11 4 77 1457 404957738 404959124 0.000000e+00 2462
7 TraesCS3B01G186900 chrUn 98.423 761 9 2 314 1073 53261896 53261138 0.000000e+00 1336
8 TraesCS3B01G186900 chr2D 97.233 2096 48 7 1 2096 334225355 334227440 0.000000e+00 3541
9 TraesCS3B01G186900 chr2D 97.744 266 6 0 1831 2096 141098401 141098136 1.890000e-125 459
10 TraesCS3B01G186900 chr2A 96.335 2101 40 7 1 2096 335825720 335827788 0.000000e+00 3419
11 TraesCS3B01G186900 chr2A 96.945 982 29 1 1 982 276441644 276440664 0.000000e+00 1646
12 TraesCS3B01G186900 chr2A 96.471 255 8 1 200 454 490417821 490417568 8.940000e-114 420
13 TraesCS3B01G186900 chr5D 97.171 2015 49 4 82 2096 6208305 6206299 0.000000e+00 3398
14 TraesCS3B01G186900 chr5D 98.498 1332 13 2 748 2072 554200515 554201846 0.000000e+00 2342
15 TraesCS3B01G186900 chr7D 95.259 1118 47 3 1 1115 88605014 88606128 0.000000e+00 1766
16 TraesCS3B01G186900 chr1A 96.863 1052 16 4 1 1050 256026725 256025689 0.000000e+00 1744
17 TraesCS3B01G186900 chr5A 96.113 952 22 2 1 951 684325030 684325967 0.000000e+00 1539
18 TraesCS3B01G186900 chr2B 97.143 140 4 0 1 140 482853930 482854069 9.670000e-59 237
19 TraesCS3B01G186900 chr2B 99.010 101 1 0 105 205 655916404 655916504 4.590000e-42 182
20 TraesCS3B01G186900 chr7A 92.632 95 6 1 108 201 140648872 140648966 3.630000e-28 135
21 TraesCS3B01G186900 chr7A 85.714 133 10 4 1 124 140648457 140648589 4.690000e-27 132
22 TraesCS3B01G186900 chr6B 94.737 76 1 2 1 73 170663841 170663766 4.730000e-22 115
23 TraesCS3B01G186900 chr4D 91.566 83 5 2 1 81 348381097 348381015 1.700000e-21 113


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G186900 chr3B 201506007 201508102 2095 False 3871 3871 100.000 1 2096 1 chr3B.!!$F1 2095
1 TraesCS3B01G186900 chr1D 394178344 394180438 2094 False 3591 3591 97.621 1 2093 1 chr1D.!!$F2 2092
2 TraesCS3B01G186900 chr1D 244443826 244445570 1744 False 2739 2739 94.986 345 2093 1 chr1D.!!$F1 1748
3 TraesCS3B01G186900 chr1D 483921434 483922592 1158 True 2052 2052 98.621 937 2096 1 chr1D.!!$R1 1159
4 TraesCS3B01G186900 chr6D 431399465 431401550 2085 False 3574 3574 97.520 1 2096 1 chr6D.!!$F1 2095
5 TraesCS3B01G186900 chrUn 317471662 317473755 2093 True 3565 3565 97.383 1 2096 1 chrUn.!!$R2 2095
6 TraesCS3B01G186900 chrUn 404957738 404959124 1386 False 2462 2462 98.774 77 1457 1 chrUn.!!$F1 1380
7 TraesCS3B01G186900 chrUn 53261138 53261896 758 True 1336 1336 98.423 314 1073 1 chrUn.!!$R1 759
8 TraesCS3B01G186900 chr2D 334225355 334227440 2085 False 3541 3541 97.233 1 2096 1 chr2D.!!$F1 2095
9 TraesCS3B01G186900 chr2A 335825720 335827788 2068 False 3419 3419 96.335 1 2096 1 chr2A.!!$F1 2095
10 TraesCS3B01G186900 chr2A 276440664 276441644 980 True 1646 1646 96.945 1 982 1 chr2A.!!$R1 981
11 TraesCS3B01G186900 chr5D 6206299 6208305 2006 True 3398 3398 97.171 82 2096 1 chr5D.!!$R1 2014
12 TraesCS3B01G186900 chr5D 554200515 554201846 1331 False 2342 2342 98.498 748 2072 1 chr5D.!!$F1 1324
13 TraesCS3B01G186900 chr7D 88605014 88606128 1114 False 1766 1766 95.259 1 1115 1 chr7D.!!$F1 1114
14 TraesCS3B01G186900 chr1A 256025689 256026725 1036 True 1744 1744 96.863 1 1050 1 chr1A.!!$R1 1049
15 TraesCS3B01G186900 chr5A 684325030 684325967 937 False 1539 1539 96.113 1 951 1 chr5A.!!$F1 950

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
359 372 5.067954 GGCCTAACTTTCTTGACCAAACTA 58.932 41.667 0.0 0.0 0.0 2.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1363 1406 4.263572 CCAACTGACCCCCACGCA 62.264 66.667 0.0 0.0 0.0 5.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
141 153 6.376299 CCCCATTTTTGTAGGTTCTACTTACC 59.624 42.308 6.63 0.00 30.56 2.85
338 351 6.071616 TCCTTGTATTGTTTGTTGGATTAGGC 60.072 38.462 0.00 0.00 0.00 3.93
359 372 5.067954 GGCCTAACTTTCTTGACCAAACTA 58.932 41.667 0.00 0.00 0.00 2.24
821 843 6.957920 TTCCACAACAAATCTCTTGATTCA 57.042 33.333 0.00 0.00 41.62 2.57
1085 1127 9.679661 TCTATTTATTGGCTTGAACAAGATACA 57.320 29.630 17.19 9.87 40.79 2.29
1310 1353 8.943002 GTTTTTCTATTTGGAATCGTCTTAGGA 58.057 33.333 0.00 0.00 0.00 2.94
1363 1406 4.494035 CGTGACTGCGTATTTGCAATACAT 60.494 41.667 0.00 0.00 45.74 2.29
1372 1415 3.119193 GCAATACATGCGTGGGGG 58.881 61.111 11.36 0.00 46.87 5.40
1556 1602 2.114411 GGGTTTTGGAGACCCGCA 59.886 61.111 0.00 0.00 46.71 5.69
1694 1740 6.331061 ACTTTAATTGATCTCGTCGCTACTT 58.669 36.000 0.00 0.00 0.00 2.24
1799 1845 0.652592 CTGCGCTACATCCCTTTTCG 59.347 55.000 9.73 0.00 0.00 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
7 8 2.865551 CAAAACCAGATTGTTGTGCCAC 59.134 45.455 0.00 0.0 0.00 5.01
141 153 7.227512 ACTCTATTATTCCGAAGCCAATGAAAG 59.772 37.037 0.00 0.0 0.00 2.62
338 351 5.987347 TCGTAGTTTGGTCAAGAAAGTTAGG 59.013 40.000 0.00 0.0 0.00 2.69
359 372 2.084681 CGTAAAGTTCCGCGCTCGT 61.085 57.895 5.56 0.0 0.00 4.18
821 843 7.732140 TCAGATGATACATGAGTCCCTAATTCT 59.268 37.037 0.00 0.0 0.00 2.40
1310 1353 7.607615 TCCCGCTAAAGTAATAGGAATTAGT 57.392 36.000 0.00 0.0 33.46 2.24
1363 1406 4.263572 CCAACTGACCCCCACGCA 62.264 66.667 0.00 0.0 0.00 5.24
1372 1415 5.702670 TGACTCAATCAAAGATCCAACTGAC 59.297 40.000 0.00 0.0 33.02 3.51
1556 1602 5.652518 GCTCTTAGTTCAGTTCGGTAGAAT 58.347 41.667 0.00 0.0 38.80 2.40
1985 2031 8.630917 GGAAAAGTAATCCTTCTTTTATAGGCC 58.369 37.037 0.00 0.0 41.79 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.