Multiple sequence alignment - TraesCS3B01G186800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G186800 chr3B 100.000 2123 0 0 1 2123 201507969 201505847 0.000000e+00 3921.0
1 TraesCS3B01G186800 chr1D 97.608 2132 35 6 1 2123 394180308 394178184 0.000000e+00 3640.0
2 TraesCS3B01G186800 chr1D 95.482 2125 47 15 1 2123 254491053 254488976 0.000000e+00 3347.0
3 TraesCS3B01G186800 chr1D 94.889 1624 68 7 1 1619 244445439 244443826 0.000000e+00 2525.0
4 TraesCS3B01G186800 chr6D 97.505 2124 41 5 1 2123 431401417 431399305 0.000000e+00 3618.0
5 TraesCS3B01G186800 chrUn 97.393 2110 41 6 1 2104 317471795 317473896 0.000000e+00 3579.0
6 TraesCS3B01G186800 chrUn 98.774 1387 11 4 507 1887 404959124 404957738 0.000000e+00 2462.0
7 TraesCS3B01G186800 chrUn 98.423 761 9 2 891 1650 53261138 53261896 0.000000e+00 1336.0
8 TraesCS3B01G186800 chr2D 97.175 2124 49 8 1 2123 334227307 334225194 0.000000e+00 3579.0
9 TraesCS3B01G186800 chr2A 96.194 2128 44 7 1 2123 335827655 335825560 0.000000e+00 3446.0
10 TraesCS3B01G186800 chr2A 96.935 1142 34 1 982 2123 276440664 276441804 0.000000e+00 1914.0
11 TraesCS3B01G186800 chr3D 95.728 2130 49 8 1 2123 21898930 21896836 0.000000e+00 3391.0
12 TraesCS3B01G186800 chr5D 97.184 1882 45 4 1 1882 6206432 6208305 0.000000e+00 3175.0
13 TraesCS3B01G186800 chr5D 96.677 1565 49 3 560 2123 329130874 329132436 0.000000e+00 2599.0
14 TraesCS3B01G186800 chr5D 98.446 1223 12 2 1 1216 554201737 554200515 0.000000e+00 2146.0
15 TraesCS3B01G186800 chr1A 97.112 1212 18 4 914 2123 256025689 256026885 0.000000e+00 2028.0
16 TraesCS3B01G186800 chr7D 95.427 1159 47 3 849 2004 88606128 88604973 0.000000e+00 1842.0
17 TraesCS3B01G186800 chr5A 96.403 1112 25 2 1013 2123 684325967 684324870 0.000000e+00 1818.0
18 TraesCS3B01G186800 chr7B 89.489 333 30 4 1795 2123 678400704 678401035 1.170000e-112 416.0
19 TraesCS3B01G186800 chr2B 97.203 143 4 0 1824 1966 482854069 482853927 2.100000e-60 243.0
20 TraesCS3B01G186800 chr2B 100.000 29 0 0 1714 1742 328327957 328327985 1.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G186800 chr3B 201505847 201507969 2122 True 3921 3921 100.000 1 2123 1 chr3B.!!$R1 2122
1 TraesCS3B01G186800 chr1D 394178184 394180308 2124 True 3640 3640 97.608 1 2123 1 chr1D.!!$R3 2122
2 TraesCS3B01G186800 chr1D 254488976 254491053 2077 True 3347 3347 95.482 1 2123 1 chr1D.!!$R2 2122
3 TraesCS3B01G186800 chr1D 244443826 244445439 1613 True 2525 2525 94.889 1 1619 1 chr1D.!!$R1 1618
4 TraesCS3B01G186800 chr6D 431399305 431401417 2112 True 3618 3618 97.505 1 2123 1 chr6D.!!$R1 2122
5 TraesCS3B01G186800 chrUn 317471795 317473896 2101 False 3579 3579 97.393 1 2104 1 chrUn.!!$F2 2103
6 TraesCS3B01G186800 chrUn 404957738 404959124 1386 True 2462 2462 98.774 507 1887 1 chrUn.!!$R1 1380
7 TraesCS3B01G186800 chrUn 53261138 53261896 758 False 1336 1336 98.423 891 1650 1 chrUn.!!$F1 759
8 TraesCS3B01G186800 chr2D 334225194 334227307 2113 True 3579 3579 97.175 1 2123 1 chr2D.!!$R1 2122
9 TraesCS3B01G186800 chr2A 335825560 335827655 2095 True 3446 3446 96.194 1 2123 1 chr2A.!!$R1 2122
10 TraesCS3B01G186800 chr2A 276440664 276441804 1140 False 1914 1914 96.935 982 2123 1 chr2A.!!$F1 1141
11 TraesCS3B01G186800 chr3D 21896836 21898930 2094 True 3391 3391 95.728 1 2123 1 chr3D.!!$R1 2122
12 TraesCS3B01G186800 chr5D 6206432 6208305 1873 False 3175 3175 97.184 1 1882 1 chr5D.!!$F1 1881
13 TraesCS3B01G186800 chr5D 329130874 329132436 1562 False 2599 2599 96.677 560 2123 1 chr5D.!!$F2 1563
14 TraesCS3B01G186800 chr5D 554200515 554201737 1222 True 2146 2146 98.446 1 1216 1 chr5D.!!$R1 1215
15 TraesCS3B01G186800 chr1A 256025689 256026885 1196 False 2028 2028 97.112 914 2123 1 chr1A.!!$F1 1209
16 TraesCS3B01G186800 chr7D 88604973 88606128 1155 True 1842 1842 95.427 849 2004 1 chr7D.!!$R1 1155
17 TraesCS3B01G186800 chr5A 684324870 684325967 1097 True 1818 1818 96.403 1013 2123 1 chr5A.!!$R1 1110

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
599 619 4.263572 CCAACTGACCCCCACGCA 62.264 66.667 0.0 0.0 0.0 5.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1624 1681 6.071616 TCCTTGTATTGTTTGTTGGATTAGGC 60.072 38.462 0.0 0.0 0.0 3.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
406 424 5.652518 GCTCTTAGTTCAGTTCGGTAGAAT 58.347 41.667 0.00 0.0 38.80 2.40
590 610 5.702670 TGACTCAATCAAAGATCCAACTGAC 59.297 40.000 0.00 0.0 33.02 3.51
599 619 4.263572 CCAACTGACCCCCACGCA 62.264 66.667 0.00 0.0 0.00 5.24
652 672 7.607615 TCCCGCTAAAGTAATAGGAATTAGT 57.392 36.000 0.00 0.0 33.46 2.24
1624 1681 5.987347 TCGTAGTTTGGTCAAGAAAGTTAGG 59.013 40.000 0.00 0.0 0.00 2.69
1821 1879 7.227512 ACTCTATTATTCCGAAGCCAATGAAAG 59.772 37.037 0.00 0.0 0.00 2.62
1955 2043 2.865551 CAAAACCAGATTGTTGTGCCAC 59.134 45.455 0.00 0.0 0.00 5.01
2005 2094 9.106070 GGTATACTCAAAATACACCTTTGGTAG 57.894 37.037 2.25 0.0 35.03 3.18
2022 2111 8.526147 CCTTTGGTAGAAAATTGACAATCTCAT 58.474 33.333 0.05 0.0 0.00 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
163 181 0.652592 CTGCGCTACATCCCTTTTCG 59.347 55.000 9.73 0.00 0.00 3.46
268 286 6.331061 ACTTTAATTGATCTCGTCGCTACTT 58.669 36.000 0.00 0.00 0.00 2.24
406 424 2.114411 GGGTTTTGGAGACCCGCA 59.886 61.111 0.00 0.00 46.71 5.69
590 610 3.119193 GCAATACATGCGTGGGGG 58.881 61.111 11.36 0.00 46.87 5.40
599 619 4.494035 CGTGACTGCGTATTTGCAATACAT 60.494 41.667 0.00 0.00 45.74 2.29
652 672 8.943002 GTTTTTCTATTTGGAATCGTCTTAGGA 58.057 33.333 0.00 0.00 0.00 2.94
877 897 9.679661 TCTATTTATTGGCTTGAACAAGATACA 57.320 29.630 17.19 9.87 40.79 2.29
1624 1681 6.071616 TCCTTGTATTGTTTGTTGGATTAGGC 60.072 38.462 0.00 0.00 0.00 3.93
1821 1879 6.376299 CCCCATTTTTGTAGGTTCTACTTACC 59.624 42.308 6.63 0.00 30.56 2.85
1955 2043 7.122948 ACCGAATTAGTATAGCTATCCTTCCTG 59.877 40.741 10.16 3.82 0.00 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.