Multiple sequence alignment - TraesCS3B01G186700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G186700 chr3B 100.000 2252 0 0 1 2252 201506849 201504598 0.000000e+00 4159
1 TraesCS3B01G186700 chr3B 97.500 120 3 0 1 120 386605388 386605269 2.930000e-49 206
2 TraesCS3B01G186700 chr2D 96.992 2261 37 8 1 2252 628285940 628283702 0.000000e+00 3770
3 TraesCS3B01G186700 chr2D 96.647 2237 52 10 1 2229 334226193 334223972 0.000000e+00 3694
4 TraesCS3B01G186700 chr6D 96.903 2260 46 8 1 2252 431400298 431398055 0.000000e+00 3764
5 TraesCS3B01G186700 chr1D 96.813 2259 52 6 1 2252 254489973 254487728 0.000000e+00 3755
6 TraesCS3B01G186700 chr2A 96.459 2259 66 4 1 2252 276440803 276443054 0.000000e+00 3716
7 TraesCS3B01G186700 chr2A 96.016 2259 61 9 1 2252 335826551 335824315 0.000000e+00 3646
8 TraesCS3B01G186700 chr2A 96.377 138 5 0 1 138 703347076 703347213 6.260000e-56 228
9 TraesCS3B01G186700 chr3D 96.459 2259 53 9 1 2252 21897827 21895589 0.000000e+00 3703
10 TraesCS3B01G186700 chr5D 96.071 2265 63 10 1 2250 329131434 329133687 0.000000e+00 3666
11 TraesCS3B01G186700 chr1A 97.191 2136 36 7 1 2129 256025895 256028013 0.000000e+00 3591
12 TraesCS3B01G186700 chr1A 98.717 1403 17 1 850 2252 554465601 554467002 0.000000e+00 2490
13 TraesCS3B01G186700 chr5A 95.531 2260 59 9 1 2252 684325859 684323634 0.000000e+00 3576
14 TraesCS3B01G186700 chr7D 95.265 887 38 2 1 884 88605858 88604973 0.000000e+00 1402
15 TraesCS3B01G186700 chrUn 98.573 771 7 2 1 767 404958508 404957738 0.000000e+00 1360


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G186700 chr3B 201504598 201506849 2251 True 4159 4159 100.000 1 2252 1 chr3B.!!$R1 2251
1 TraesCS3B01G186700 chr2D 628283702 628285940 2238 True 3770 3770 96.992 1 2252 1 chr2D.!!$R2 2251
2 TraesCS3B01G186700 chr2D 334223972 334226193 2221 True 3694 3694 96.647 1 2229 1 chr2D.!!$R1 2228
3 TraesCS3B01G186700 chr6D 431398055 431400298 2243 True 3764 3764 96.903 1 2252 1 chr6D.!!$R1 2251
4 TraesCS3B01G186700 chr1D 254487728 254489973 2245 True 3755 3755 96.813 1 2252 1 chr1D.!!$R1 2251
5 TraesCS3B01G186700 chr2A 276440803 276443054 2251 False 3716 3716 96.459 1 2252 1 chr2A.!!$F1 2251
6 TraesCS3B01G186700 chr2A 335824315 335826551 2236 True 3646 3646 96.016 1 2252 1 chr2A.!!$R1 2251
7 TraesCS3B01G186700 chr3D 21895589 21897827 2238 True 3703 3703 96.459 1 2252 1 chr3D.!!$R1 2251
8 TraesCS3B01G186700 chr5D 329131434 329133687 2253 False 3666 3666 96.071 1 2250 1 chr5D.!!$F1 2249
9 TraesCS3B01G186700 chr1A 256025895 256028013 2118 False 3591 3591 97.191 1 2129 1 chr1A.!!$F1 2128
10 TraesCS3B01G186700 chr1A 554465601 554467002 1401 False 2490 2490 98.717 850 2252 1 chr1A.!!$F2 1402
11 TraesCS3B01G186700 chr5A 684323634 684325859 2225 True 3576 3576 95.531 1 2252 1 chr5A.!!$R1 2251
12 TraesCS3B01G186700 chr7D 88604973 88605858 885 True 1402 1402 95.265 1 884 1 chr7D.!!$R1 883
13 TraesCS3B01G186700 chrUn 404957738 404958508 770 True 1360 1360 98.573 1 767 1 chrUn.!!$R1 766

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
835 871 2.865551 CAAAACCAGATTGTTGTGCCAC 59.134 45.455 0.0 0.0 0.0 5.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2187 2248 1.551883 GGTTTAGCCGAGGTAGTGGAA 59.448 52.381 0.0 0.0 0.0 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
504 517 5.987347 TCGTAGTTTGGTCAAGAAAGTTAGG 59.013 40.000 0.00 0.0 0.00 2.69
701 714 7.227512 ACTCTATTATTCCGAAGCCAATGAAAG 59.772 37.037 0.00 0.0 0.00 2.62
835 871 2.865551 CAAAACCAGATTGTTGTGCCAC 59.134 45.455 0.00 0.0 0.00 5.01
885 922 9.106070 GGTATACTCAAAATACACCTTTGGTAG 57.894 37.037 2.25 0.0 35.03 3.18
902 939 8.526147 CCTTTGGTAGAAAATTGACAATCTCAT 58.474 33.333 0.05 0.0 0.00 2.90
1291 1328 8.532819 ACCATAGATCGAACCTATCCTATTTTC 58.467 37.037 7.49 0.0 0.00 2.29
1365 1403 2.815503 TGGGATCAATATCAGCAATGCG 59.184 45.455 0.00 0.0 33.41 4.73
1426 1464 3.481453 TGACACAATCAAACCCGAATGA 58.519 40.909 0.00 0.0 33.02 2.57
1593 1631 8.701908 ATACCGTCCTTATAACTACTCATGAA 57.298 34.615 0.00 0.0 0.00 2.57
1765 1805 2.988010 TCTGGATTGGGTTCATCTCG 57.012 50.000 0.00 0.0 0.00 4.04
2126 2182 9.601217 TTAAACTTAATTAAACAAGCCAAGCAA 57.399 25.926 0.00 0.0 0.00 3.91
2127 2183 8.675705 AAACTTAATTAAACAAGCCAAGCAAT 57.324 26.923 0.00 0.0 0.00 3.56
2128 2184 8.675705 AACTTAATTAAACAAGCCAAGCAATT 57.324 26.923 0.00 0.0 0.00 2.32
2129 2185 8.310406 ACTTAATTAAACAAGCCAAGCAATTC 57.690 30.769 0.00 0.0 0.00 2.17
2130 2186 8.150296 ACTTAATTAAACAAGCCAAGCAATTCT 58.850 29.630 0.00 0.0 0.00 2.40
2187 2248 5.187772 GCCATATTTTCTTCCCCTCTGTTTT 59.812 40.000 0.00 0.0 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
504 517 6.071616 TCCTTGTATTGTTTGTTGGATTAGGC 60.072 38.462 0.00 0.00 0.00 3.93
701 714 6.376299 CCCCATTTTTGTAGGTTCTACTTACC 59.624 42.308 6.63 0.00 30.56 2.85
835 871 7.122948 ACCGAATTAGTATAGCTATCCTTCCTG 59.877 40.741 10.16 3.82 0.00 3.86
1291 1328 2.857575 TAGCCAGCCATCGCACTGTG 62.858 60.000 2.76 2.76 37.52 3.66
1426 1464 8.760569 GGTACGATTCAATTCAACATTTTGTTT 58.239 29.630 0.00 0.00 38.77 2.83
1587 1625 7.391275 TCATGCTAGAGACAAAAACATTCATGA 59.609 33.333 0.00 0.00 34.81 3.07
1593 1631 5.316167 TGGTCATGCTAGAGACAAAAACAT 58.684 37.500 11.05 0.00 36.50 2.71
1765 1805 3.764218 TCTGGTCCCTCCGATTACTATC 58.236 50.000 0.00 0.00 39.52 2.08
2102 2158 8.675705 ATTGCTTGGCTTGTTTAATTAAGTTT 57.324 26.923 0.00 0.00 0.00 2.66
2187 2248 1.551883 GGTTTAGCCGAGGTAGTGGAA 59.448 52.381 0.00 0.00 0.00 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.