Multiple sequence alignment - TraesCS3B01G186600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G186600 chr3B 100.000 2120 0 0 1 2120 201506587 201504468 0.000000e+00 3916
1 TraesCS3B01G186600 chr3B 96.429 140 4 1 399 537 21016929 21017068 1.640000e-56 230
2 TraesCS3B01G186600 chr2D 97.461 2127 25 6 1 2120 628285676 628283572 0.000000e+00 3602
3 TraesCS3B01G186600 chr2D 96.557 1975 45 10 1 1967 334225931 334223972 0.000000e+00 3249
4 TraesCS3B01G186600 chr6D 97.132 2127 34 8 1 2120 431400035 431397929 0.000000e+00 3565
5 TraesCS3B01G186600 chr1D 97.084 2126 43 5 1 2120 254489710 254487598 0.000000e+00 3565
6 TraesCS3B01G186600 chr1D 97.789 1357 18 4 1 1353 394178921 394177573 0.000000e+00 2329
7 TraesCS3B01G186600 chr3D 96.847 2125 42 7 1 2120 21897563 21895459 0.000000e+00 3530
8 TraesCS3B01G186600 chr5D 96.628 2135 47 9 1 2120 329131695 329133819 0.000000e+00 3520
9 TraesCS3B01G186600 chr2A 96.568 2127 59 4 1 2120 276441065 276443184 0.000000e+00 3511
10 TraesCS3B01G186600 chr2A 95.957 2127 57 9 1 2120 335826288 335824184 0.000000e+00 3424
11 TraesCS3B01G186600 chr1A 98.761 1533 18 1 588 2120 554465601 554467132 0.000000e+00 2724
12 TraesCS3B01G186600 chrUn 97.376 724 10 2 1 722 317473180 317473896 0.000000e+00 1223
13 TraesCS3B01G186600 chr7D 95.680 625 23 2 1 622 88605596 88604973 0.000000e+00 1002
14 TraesCS3B01G186600 chr2B 97.203 143 4 0 442 584 482854069 482853927 2.100000e-60 243


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G186600 chr3B 201504468 201506587 2119 True 3916 3916 100.000 1 2120 1 chr3B.!!$R1 2119
1 TraesCS3B01G186600 chr2D 628283572 628285676 2104 True 3602 3602 97.461 1 2120 1 chr2D.!!$R2 2119
2 TraesCS3B01G186600 chr2D 334223972 334225931 1959 True 3249 3249 96.557 1 1967 1 chr2D.!!$R1 1966
3 TraesCS3B01G186600 chr6D 431397929 431400035 2106 True 3565 3565 97.132 1 2120 1 chr6D.!!$R1 2119
4 TraesCS3B01G186600 chr1D 254487598 254489710 2112 True 3565 3565 97.084 1 2120 1 chr1D.!!$R1 2119
5 TraesCS3B01G186600 chr1D 394177573 394178921 1348 True 2329 2329 97.789 1 1353 1 chr1D.!!$R2 1352
6 TraesCS3B01G186600 chr3D 21895459 21897563 2104 True 3530 3530 96.847 1 2120 1 chr3D.!!$R1 2119
7 TraesCS3B01G186600 chr5D 329131695 329133819 2124 False 3520 3520 96.628 1 2120 1 chr5D.!!$F1 2119
8 TraesCS3B01G186600 chr2A 276441065 276443184 2119 False 3511 3511 96.568 1 2120 1 chr2A.!!$F1 2119
9 TraesCS3B01G186600 chr2A 335824184 335826288 2104 True 3424 3424 95.957 1 2120 1 chr2A.!!$R1 2119
10 TraesCS3B01G186600 chr1A 554465601 554467132 1531 False 2724 2724 98.761 588 2120 1 chr1A.!!$F1 1532
11 TraesCS3B01G186600 chrUn 317473180 317473896 716 False 1223 1223 97.376 1 722 1 chrUn.!!$F1 721
12 TraesCS3B01G186600 chr7D 88604973 88605596 623 True 1002 1002 95.680 1 622 1 chr7D.!!$R1 621

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
565 601 2.08661 ACCAGGCAAAACCAGATTGT 57.913 45.0 0.0 0.0 43.14 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1925 1985 1.551883 GGTTTAGCCGAGGTAGTGGAA 59.448 52.381 0.0 0.0 0.0 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
143 147 4.994852 CCAACCAAAGTAGATTCGAAGACA 59.005 41.667 3.35 0.0 34.32 3.41
242 246 5.987347 TCGTAGTTTGGTCAAGAAAGTTAGG 59.013 40.000 0.00 0.0 0.00 2.69
269 273 8.531146 CCTAATCCAACAAACAATACAAGGATT 58.469 33.333 0.00 0.0 44.33 3.01
439 444 7.227512 ACTCTATTATTCCGAAGCCAATGAAAG 59.772 37.037 0.00 0.0 0.00 2.62
565 601 2.086610 ACCAGGCAAAACCAGATTGT 57.913 45.000 0.00 0.0 43.14 2.71
573 609 2.865551 CAAAACCAGATTGTTGTGCCAC 59.134 45.455 0.00 0.0 0.00 5.01
623 660 9.106070 GGTATACTCAAAATACACCTTTGGTAG 57.894 37.037 2.25 0.0 35.03 3.18
640 677 8.526147 CCTTTGGTAGAAAATTGACAATCTCAT 58.474 33.333 0.05 0.0 0.00 2.90
1029 1066 8.532819 ACCATAGATCGAACCTATCCTATTTTC 58.467 37.037 7.49 0.0 0.00 2.29
1103 1140 2.815503 TGGGATCAATATCAGCAATGCG 59.184 45.455 0.00 0.0 33.41 4.73
1164 1201 3.481453 TGACACAATCAAACCCGAATGA 58.519 40.909 0.00 0.0 33.02 2.57
1331 1368 8.701908 ATACCGTCCTTATAACTACTCATGAA 57.298 34.615 0.00 0.0 0.00 2.57
1503 1541 2.988010 TCTGGATTGGGTTCATCTCG 57.012 50.000 0.00 0.0 0.00 4.04
1864 1919 9.601217 TTAAACTTAATTAAACAAGCCAAGCAA 57.399 25.926 0.00 0.0 0.00 3.91
1865 1920 8.675705 AAACTTAATTAAACAAGCCAAGCAAT 57.324 26.923 0.00 0.0 0.00 3.56
1866 1921 8.675705 AACTTAATTAAACAAGCCAAGCAATT 57.324 26.923 0.00 0.0 0.00 2.32
1867 1922 8.310406 ACTTAATTAAACAAGCCAAGCAATTC 57.690 30.769 0.00 0.0 0.00 2.17
1868 1923 8.150296 ACTTAATTAAACAAGCCAAGCAATTCT 58.850 29.630 0.00 0.0 0.00 2.40
1925 1985 5.187772 GCCATATTTTCTTCCCCTCTGTTTT 59.812 40.000 0.00 0.0 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
242 246 6.071616 TCCTTGTATTGTTTGTTGGATTAGGC 60.072 38.462 0.00 0.00 0.00 3.93
439 444 6.376299 CCCCATTTTTGTAGGTTCTACTTACC 59.624 42.308 6.63 0.00 30.56 2.85
565 601 1.340017 GCTATCCTTCCTGTGGCACAA 60.340 52.381 22.31 4.63 44.16 3.33
573 609 7.122948 ACCGAATTAGTATAGCTATCCTTCCTG 59.877 40.741 10.16 3.82 0.00 3.86
1029 1066 2.857575 TAGCCAGCCATCGCACTGTG 62.858 60.000 2.76 2.76 37.52 3.66
1164 1201 8.760569 GGTACGATTCAATTCAACATTTTGTTT 58.239 29.630 0.00 0.00 38.77 2.83
1325 1362 7.391275 TCATGCTAGAGACAAAAACATTCATGA 59.609 33.333 0.00 0.00 34.81 3.07
1331 1368 5.316167 TGGTCATGCTAGAGACAAAAACAT 58.684 37.500 11.05 0.00 36.50 2.71
1503 1541 3.764218 TCTGGTCCCTCCGATTACTATC 58.236 50.000 0.00 0.00 39.52 2.08
1840 1895 8.675705 ATTGCTTGGCTTGTTTAATTAAGTTT 57.324 26.923 0.00 0.00 0.00 2.66
1925 1985 1.551883 GGTTTAGCCGAGGTAGTGGAA 59.448 52.381 0.00 0.00 0.00 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.