Multiple sequence alignment - TraesCS3B01G186500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G186500 chr3B 100.000 2118 0 0 1 2118 201506445 201504328 0.000000e+00 3912
1 TraesCS3B01G186500 chr2D 97.363 2124 27 6 3 2118 628285533 628283431 0.000000e+00 3585
2 TraesCS3B01G186500 chr2D 96.505 1831 43 9 3 1825 334225789 334223972 0.000000e+00 3007
3 TraesCS3B01G186500 chr2D 97.213 1543 20 6 585 2118 628288213 628286685 0.000000e+00 2590
4 TraesCS3B01G186500 chr6D 97.175 2124 35 7 3 2118 431399894 431397788 0.000000e+00 3567
5 TraesCS3B01G186500 chr1D 96.984 2122 45 5 3 2118 254489565 254487457 0.000000e+00 3546
6 TraesCS3B01G186500 chr1D 95.226 2032 73 11 89 2118 244408395 244406386 0.000000e+00 3193
7 TraesCS3B01G186500 chr1D 95.128 2032 75 11 89 2118 244401944 244399935 0.000000e+00 3182
8 TraesCS3B01G186500 chr1D 94.251 2035 90 12 89 2118 244423932 244421920 0.000000e+00 3085
9 TraesCS3B01G186500 chr1D 97.851 1210 17 3 3 1211 394178774 394177573 0.000000e+00 2082
10 TraesCS3B01G186500 chr3D 96.795 2122 46 7 3 2118 21897423 21895318 0.000000e+00 3522
11 TraesCS3B01G186500 chr1A 98.686 1674 20 2 446 2118 554465601 554467273 0.000000e+00 2968
12 TraesCS3B01G186500 chr1A 97.106 1728 28 5 3 1725 256026303 256028013 0.000000e+00 2894
13 TraesCS3B01G186500 chrUn 97.232 578 9 1 3 580 317473326 317473896 0.000000e+00 972
14 TraesCS3B01G186500 chrUn 99.174 363 3 0 1 363 404958100 404957738 0.000000e+00 654
15 TraesCS3B01G186500 chr7D 95.842 481 16 2 3 480 88605452 88604973 0.000000e+00 774
16 TraesCS3B01G186500 chr2B 97.203 143 4 0 300 442 482854069 482853927 2.100000e-60 243


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G186500 chr3B 201504328 201506445 2117 True 3912.0 3912 100.000 1 2118 1 chr3B.!!$R1 2117
1 TraesCS3B01G186500 chr2D 628283431 628288213 4782 True 3087.5 3585 97.288 3 2118 2 chr2D.!!$R2 2115
2 TraesCS3B01G186500 chr2D 334223972 334225789 1817 True 3007.0 3007 96.505 3 1825 1 chr2D.!!$R1 1822
3 TraesCS3B01G186500 chr6D 431397788 431399894 2106 True 3567.0 3567 97.175 3 2118 1 chr6D.!!$R1 2115
4 TraesCS3B01G186500 chr1D 254487457 254489565 2108 True 3546.0 3546 96.984 3 2118 1 chr1D.!!$R4 2115
5 TraesCS3B01G186500 chr1D 244406386 244408395 2009 True 3193.0 3193 95.226 89 2118 1 chr1D.!!$R2 2029
6 TraesCS3B01G186500 chr1D 244399935 244401944 2009 True 3182.0 3182 95.128 89 2118 1 chr1D.!!$R1 2029
7 TraesCS3B01G186500 chr1D 244421920 244423932 2012 True 3085.0 3085 94.251 89 2118 1 chr1D.!!$R3 2029
8 TraesCS3B01G186500 chr1D 394177573 394178774 1201 True 2082.0 2082 97.851 3 1211 1 chr1D.!!$R5 1208
9 TraesCS3B01G186500 chr3D 21895318 21897423 2105 True 3522.0 3522 96.795 3 2118 1 chr3D.!!$R1 2115
10 TraesCS3B01G186500 chr1A 554465601 554467273 1672 False 2968.0 2968 98.686 446 2118 1 chr1A.!!$F2 1672
11 TraesCS3B01G186500 chr1A 256026303 256028013 1710 False 2894.0 2894 97.106 3 1725 1 chr1A.!!$F1 1722
12 TraesCS3B01G186500 chrUn 317473326 317473896 570 False 972.0 972 97.232 3 580 1 chrUn.!!$F1 577

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
79 2758 2.084681 CGTAAAGTTCCGCGCTCGT 61.085 57.895 5.56 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1783 4494 1.551883 GGTTTAGCCGAGGTAGTGGAA 59.448 52.381 0.0 0.0 0.0 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 2758 2.084681 CGTAAAGTTCCGCGCTCGT 61.085 57.895 5.56 0.0 0.00 4.18
100 2779 5.987347 TCGTAGTTTGGTCAAGAAAGTTAGG 59.013 40.000 0.00 0.0 0.00 2.69
127 2806 8.531146 CCTAATCCAACAAACAATACAAGGATT 58.469 33.333 0.00 0.0 44.33 3.01
297 2978 7.227512 ACTCTATTATTCCGAAGCCAATGAAAG 59.772 37.037 0.00 0.0 0.00 2.62
431 3126 2.865551 CAAAACCAGATTGTTGTGCCAC 59.134 45.455 0.00 0.0 0.00 5.01
481 3177 9.106070 GGTATACTCAAAATACACCTTTGGTAG 57.894 37.037 2.25 0.0 35.03 3.18
498 3194 8.526147 CCTTTGGTAGAAAATTGACAATCTCAT 58.474 33.333 0.05 0.0 0.00 2.90
609 3305 2.089980 GTTCAGCATGTCTGGAAGCAT 58.910 47.619 14.50 0.0 43.06 3.79
887 3583 8.532819 ACCATAGATCGAACCTATCCTATTTTC 58.467 37.037 7.49 0.0 0.00 2.29
961 3657 2.815503 TGGGATCAATATCAGCAATGCG 59.184 45.455 0.00 0.0 33.41 4.73
1022 3718 3.481453 TGACACAATCAAACCCGAATGA 58.519 40.909 0.00 0.0 33.02 2.57
1189 3885 8.701908 ATACCGTCCTTATAACTACTCATGAA 57.298 34.615 0.00 0.0 0.00 2.57
1361 4058 2.988010 TCTGGATTGGGTTCATCTCG 57.012 50.000 0.00 0.0 0.00 4.04
1722 4428 9.601217 TTAAACTTAATTAAACAAGCCAAGCAA 57.399 25.926 0.00 0.0 0.00 3.91
1723 4429 8.675705 AAACTTAATTAAACAAGCCAAGCAAT 57.324 26.923 0.00 0.0 0.00 3.56
1724 4430 8.675705 AACTTAATTAAACAAGCCAAGCAATT 57.324 26.923 0.00 0.0 0.00 2.32
1725 4431 8.310406 ACTTAATTAAACAAGCCAAGCAATTC 57.690 30.769 0.00 0.0 0.00 2.17
1726 4432 8.150296 ACTTAATTAAACAAGCCAAGCAATTCT 58.850 29.630 0.00 0.0 0.00 2.40
1783 4494 5.187772 GCCATATTTTCTTCCCCTCTGTTTT 59.812 40.000 0.00 0.0 0.00 2.43
1973 4684 0.620556 GAAGACCTGCAATCCCTCCA 59.379 55.000 0.00 0.0 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
79 2758 5.067954 GGCCTAACTTTCTTGACCAAACTA 58.932 41.667 0.00 0.00 0.00 2.24
100 2779 6.071616 TCCTTGTATTGTTTGTTGGATTAGGC 60.072 38.462 0.00 0.00 0.00 3.93
297 2978 6.376299 CCCCATTTTTGTAGGTTCTACTTACC 59.624 42.308 6.63 0.00 30.56 2.85
431 3126 7.122948 ACCGAATTAGTATAGCTATCCTTCCTG 59.877 40.741 10.16 3.82 0.00 3.86
609 3305 3.831323 TCAGCAAAAGAACATTCTCCCA 58.169 40.909 0.00 0.00 36.28 4.37
887 3583 2.857575 TAGCCAGCCATCGCACTGTG 62.858 60.000 2.76 2.76 37.52 3.66
1022 3718 8.760569 GGTACGATTCAATTCAACATTTTGTTT 58.239 29.630 0.00 0.00 38.77 2.83
1189 3885 5.316167 TGGTCATGCTAGAGACAAAAACAT 58.684 37.500 11.05 0.00 36.50 2.71
1361 4058 3.764218 TCTGGTCCCTCCGATTACTATC 58.236 50.000 0.00 0.00 39.52 2.08
1698 4404 8.675705 ATTGCTTGGCTTGTTTAATTAAGTTT 57.324 26.923 0.00 0.00 0.00 2.66
1783 4494 1.551883 GGTTTAGCCGAGGTAGTGGAA 59.448 52.381 0.00 0.00 0.00 3.53
1986 4697 8.655970 GCAAAGGCGAGAACAATAAAATTAAAT 58.344 29.630 0.00 0.00 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.