Multiple sequence alignment - TraesCS3B01G186400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G186400 chr3B 100.000 2144 0 0 1 2144 201506223 201504080 0.000000e+00 3960
1 TraesCS3B01G186400 chr2D 97.260 2153 29 7 1 2144 628285313 628283182 0.000000e+00 3622
2 TraesCS3B01G186400 chr1D 96.885 2151 47 6 1 2144 254489345 254487208 0.000000e+00 3583
3 TraesCS3B01G186400 chr1D 94.734 2146 76 14 1 2144 244408261 244406151 0.000000e+00 3302
4 TraesCS3B01G186400 chr1D 94.501 2146 81 14 1 2144 244401810 244399700 0.000000e+00 3275
5 TraesCS3B01G186400 chr1D 93.767 2150 93 16 1 2144 244423798 244421684 0.000000e+00 3190
6 TraesCS3B01G186400 chr1D 97.677 990 14 3 1 989 394178554 394177573 0.000000e+00 1692
7 TraesCS3B01G186400 chr3D 96.885 2151 45 7 1 2144 21897204 21895069 0.000000e+00 3581
8 TraesCS3B01G186400 chr6D 96.959 2072 37 8 1 2063 431399674 431397620 0.000000e+00 3454
9 TraesCS3B01G186400 chr1A 98.648 1923 23 3 224 2144 554465601 554467522 0.000000e+00 3404
10 TraesCS3B01G186400 chr1A 96.883 1508 25 5 1 1503 256026523 256028013 0.000000e+00 2505
11 TraesCS3B01G186400 chr5A 95.402 2153 56 13 1 2144 684325232 684323114 0.000000e+00 3387
12 TraesCS3B01G186400 chrUn 96.648 358 5 1 1 358 317473546 317473896 2.370000e-164 588
13 TraesCS3B01G186400 chr2B 98.730 315 3 1 273 586 613236039 613236353 1.860000e-155 558
14 TraesCS3B01G186400 chr7D 95.785 261 8 1 1 258 88605233 88604973 3.290000e-113 418
15 TraesCS3B01G186400 chr4B 97.608 209 5 0 1936 2144 288361966 288361758 2.020000e-95 359
16 TraesCS3B01G186400 chr7A 87.662 154 10 4 94 238 140648589 140648436 1.020000e-38 171


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G186400 chr3B 201504080 201506223 2143 True 3960 3960 100.000 1 2144 1 chr3B.!!$R1 2143
1 TraesCS3B01G186400 chr2D 628283182 628285313 2131 True 3622 3622 97.260 1 2144 1 chr2D.!!$R1 2143
2 TraesCS3B01G186400 chr1D 254487208 254489345 2137 True 3583 3583 96.885 1 2144 1 chr1D.!!$R4 2143
3 TraesCS3B01G186400 chr1D 244406151 244408261 2110 True 3302 3302 94.734 1 2144 1 chr1D.!!$R2 2143
4 TraesCS3B01G186400 chr1D 244399700 244401810 2110 True 3275 3275 94.501 1 2144 1 chr1D.!!$R1 2143
5 TraesCS3B01G186400 chr1D 244421684 244423798 2114 True 3190 3190 93.767 1 2144 1 chr1D.!!$R3 2143
6 TraesCS3B01G186400 chr1D 394177573 394178554 981 True 1692 1692 97.677 1 989 1 chr1D.!!$R5 988
7 TraesCS3B01G186400 chr3D 21895069 21897204 2135 True 3581 3581 96.885 1 2144 1 chr3D.!!$R1 2143
8 TraesCS3B01G186400 chr6D 431397620 431399674 2054 True 3454 3454 96.959 1 2063 1 chr6D.!!$R1 2062
9 TraesCS3B01G186400 chr1A 554465601 554467522 1921 False 3404 3404 98.648 224 2144 1 chr1A.!!$F2 1920
10 TraesCS3B01G186400 chr1A 256026523 256028013 1490 False 2505 2505 96.883 1 1503 1 chr1A.!!$F1 1502
11 TraesCS3B01G186400 chr5A 684323114 684325232 2118 True 3387 3387 95.402 1 2144 1 chr5A.!!$R1 2143

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
387 390 2.08998 GTTCAGCATGTCTGGAAGCAT 58.91 47.619 14.5 0.0 43.06 3.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1561 1586 1.551883 GGTTTAGCCGAGGTAGTGGAA 59.448 52.381 0.0 0.0 0.0 3.53 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
75 78 7.227512 ACTCTATTATTCCGAAGCCAATGAAAG 59.772 37.037 0.00 0.0 0.00 2.62
209 212 2.865551 CAAAACCAGATTGTTGTGCCAC 59.134 45.455 0.00 0.0 0.00 5.01
259 262 9.106070 GGTATACTCAAAATACACCTTTGGTAG 57.894 37.037 2.25 0.0 35.03 3.18
276 279 8.526147 CCTTTGGTAGAAAATTGACAATCTCAT 58.474 33.333 0.05 0.0 0.00 2.90
387 390 2.089980 GTTCAGCATGTCTGGAAGCAT 58.910 47.619 14.50 0.0 43.06 3.79
665 668 8.532819 ACCATAGATCGAACCTATCCTATTTTC 58.467 37.037 7.49 0.0 0.00 2.29
739 743 2.815503 TGGGATCAATATCAGCAATGCG 59.184 45.455 0.00 0.0 33.41 4.73
800 804 3.481453 TGACACAATCAAACCCGAATGA 58.519 40.909 0.00 0.0 33.02 2.57
967 972 8.701908 ATACCGTCCTTATAACTACTCATGAA 57.298 34.615 0.00 0.0 0.00 2.57
1139 1145 2.988010 TCTGGATTGGGTTCATCTCG 57.012 50.000 0.00 0.0 0.00 4.04
1500 1520 9.601217 TTAAACTTAATTAAACAAGCCAAGCAA 57.399 25.926 0.00 0.0 0.00 3.91
1501 1521 8.675705 AAACTTAATTAAACAAGCCAAGCAAT 57.324 26.923 0.00 0.0 0.00 3.56
1502 1522 8.675705 AACTTAATTAAACAAGCCAAGCAATT 57.324 26.923 0.00 0.0 0.00 2.32
1503 1523 8.310406 ACTTAATTAAACAAGCCAAGCAATTC 57.690 30.769 0.00 0.0 0.00 2.17
1504 1524 8.150296 ACTTAATTAAACAAGCCAAGCAATTCT 58.850 29.630 0.00 0.0 0.00 2.40
1561 1586 5.187772 GCCATATTTTCTTCCCCTCTGTTTT 59.812 40.000 0.00 0.0 0.00 2.43
2050 2092 6.694411 CCAAAATAATGGATGCGAAGAAGAAG 59.306 38.462 0.00 0.0 43.54 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
75 78 6.376299 CCCCATTTTTGTAGGTTCTACTTACC 59.624 42.308 6.63 0.00 30.56 2.85
209 212 7.122948 ACCGAATTAGTATAGCTATCCTTCCTG 59.877 40.741 10.16 3.82 0.00 3.86
387 390 3.831323 TCAGCAAAAGAACATTCTCCCA 58.169 40.909 0.00 0.00 36.28 4.37
665 668 2.857575 TAGCCAGCCATCGCACTGTG 62.858 60.000 2.76 2.76 37.52 3.66
800 804 8.760569 GGTACGATTCAATTCAACATTTTGTTT 58.239 29.630 0.00 0.00 38.77 2.83
967 972 5.316167 TGGTCATGCTAGAGACAAAAACAT 58.684 37.500 11.05 0.00 36.50 2.71
1139 1145 3.764218 TCTGGTCCCTCCGATTACTATC 58.236 50.000 0.00 0.00 39.52 2.08
1476 1496 8.675705 ATTGCTTGGCTTGTTTAATTAAGTTT 57.324 26.923 0.00 0.00 0.00 2.66
1561 1586 1.551883 GGTTTAGCCGAGGTAGTGGAA 59.448 52.381 0.00 0.00 0.00 3.53
1764 1789 8.655970 GCAAAGGCGAGAACAATAAAATTAAAT 58.344 29.630 0.00 0.00 0.00 1.40
2050 2092 1.886886 TACGTGTCCAAGGCCTTTTC 58.113 50.000 17.61 9.74 0.00 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.