Multiple sequence alignment - TraesCS3B01G186200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G186200 chr3B 100.000 2111 0 0 1 2111 201499912 201502022 0.000000e+00 3899
1 TraesCS3B01G186200 chr1A 98.894 1898 18 2 216 2111 554471482 554469586 0.000000e+00 3386
2 TraesCS3B01G186200 chr1A 98.747 479 5 1 1 479 554472224 554471747 0.000000e+00 850
3 TraesCS3B01G186200 chr5D 98.970 1262 12 1 850 2111 6217243 6215983 0.000000e+00 2257
4 TraesCS3B01G186200 chr5D 98.458 1232 9 1 880 2111 6213191 6214412 0.000000e+00 2161
5 TraesCS3B01G186200 chr5D 98.811 1009 12 0 1103 2111 6213208 6212200 0.000000e+00 1797
6 TraesCS3B01G186200 chr5D 97.602 417 3 3 1 416 6217828 6217418 0.000000e+00 708
7 TraesCS3B01G186200 chr5D 97.304 408 3 3 1 405 483801402 483801000 0.000000e+00 686
8 TraesCS3B01G186200 chr2D 98.811 1262 14 1 850 2111 643860300 643861560 0.000000e+00 2246
9 TraesCS3B01G186200 chr2D 96.643 417 8 2 1 416 643859715 643860126 0.000000e+00 688
10 TraesCS3B01G186200 chr6D 98.574 1262 16 2 850 2111 431396949 431395690 0.000000e+00 2230
11 TraesCS3B01G186200 chr1D 98.336 1262 20 1 850 2111 254483926 254485186 0.000000e+00 2213
12 TraesCS3B01G186200 chr1D 96.440 927 28 4 850 1773 244396702 244397626 0.000000e+00 1524
13 TraesCS3B01G186200 chr1D 96.121 928 29 4 850 1773 244403141 244404065 0.000000e+00 1507
14 TraesCS3B01G186200 chr1D 93.909 788 32 6 1 779 244393765 244394545 0.000000e+00 1175
15 TraesCS3B01G186200 chrUn 98.966 1064 11 0 856 1919 444441717 444442780 0.000000e+00 1905
16 TraesCS3B01G186200 chrUn 98.489 397 5 1 1 397 446839443 446839048 0.000000e+00 699
17 TraesCS3B01G186200 chr3A 98.362 1038 13 3 177 1212 593321850 593320815 0.000000e+00 1820
18 TraesCS3B01G186200 chr3A 95.211 877 19 8 1 862 393238014 393237146 0.000000e+00 1365
19 TraesCS3B01G186200 chr3A 99.050 737 6 1 1 737 435414681 435413946 0.000000e+00 1321
20 TraesCS3B01G186200 chr7A 94.260 662 33 2 1454 2111 710799160 710799820 0.000000e+00 1007
21 TraesCS3B01G186200 chr7B 98.301 471 6 2 481 950 300903252 300902783 0.000000e+00 824
22 TraesCS3B01G186200 chr7B 96.721 122 3 1 741 862 149444836 149444956 3.550000e-48 202
23 TraesCS3B01G186200 chr5B 95.894 414 14 2 416 829 559429704 559430114 0.000000e+00 667
24 TraesCS3B01G186200 chr4B 98.397 312 5 0 460 771 421404471 421404160 1.100000e-152 549
25 TraesCS3B01G186200 chr6A 98.071 311 6 0 423 733 495543357 495543047 1.840000e-150 542
26 TraesCS3B01G186200 chr6B 98.182 275 4 1 712 985 204449447 204449173 1.470000e-131 479
27 TraesCS3B01G186200 chr5A 91.204 216 15 3 643 855 11090770 11090984 7.370000e-75 291


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G186200 chr3B 201499912 201502022 2110 False 3899.000000 3899 100.0000 1 2111 1 chr3B.!!$F1 2110
1 TraesCS3B01G186200 chr1A 554469586 554472224 2638 True 2118.000000 3386 98.8205 1 2111 2 chr1A.!!$R1 2110
2 TraesCS3B01G186200 chr5D 6213191 6214412 1221 False 2161.000000 2161 98.4580 880 2111 1 chr5D.!!$F1 1231
3 TraesCS3B01G186200 chr5D 6212200 6217828 5628 True 1587.333333 2257 98.4610 1 2111 3 chr5D.!!$R2 2110
4 TraesCS3B01G186200 chr2D 643859715 643861560 1845 False 1467.000000 2246 97.7270 1 2111 2 chr2D.!!$F1 2110
5 TraesCS3B01G186200 chr6D 431395690 431396949 1259 True 2230.000000 2230 98.5740 850 2111 1 chr6D.!!$R1 1261
6 TraesCS3B01G186200 chr1D 254483926 254485186 1260 False 2213.000000 2213 98.3360 850 2111 1 chr1D.!!$F2 1261
7 TraesCS3B01G186200 chr1D 244403141 244404065 924 False 1507.000000 1507 96.1210 850 1773 1 chr1D.!!$F1 923
8 TraesCS3B01G186200 chr1D 244393765 244397626 3861 False 1349.500000 1524 95.1745 1 1773 2 chr1D.!!$F3 1772
9 TraesCS3B01G186200 chrUn 444441717 444442780 1063 False 1905.000000 1905 98.9660 856 1919 1 chrUn.!!$F1 1063
10 TraesCS3B01G186200 chr3A 593320815 593321850 1035 True 1820.000000 1820 98.3620 177 1212 1 chr3A.!!$R3 1035
11 TraesCS3B01G186200 chr3A 393237146 393238014 868 True 1365.000000 1365 95.2110 1 862 1 chr3A.!!$R1 861
12 TraesCS3B01G186200 chr3A 435413946 435414681 735 True 1321.000000 1321 99.0500 1 737 1 chr3A.!!$R2 736
13 TraesCS3B01G186200 chr7A 710799160 710799820 660 False 1007.000000 1007 94.2600 1454 2111 1 chr7A.!!$F1 657

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
800 1436 5.06192 ACGTTTGAAACTTTTAACAGGCA 57.938 34.783 6.49 0.0 0.0 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1869 8425 0.184933 CTGGCCCCGGATTTCCATAA 59.815 55.0 0.73 0.0 35.14 1.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
608 1244 6.958767 CCTGGAAAAGGTAGAAGAATAGGAA 58.041 40.000 0.00 0.0 41.74 3.36
800 1436 5.061920 ACGTTTGAAACTTTTAACAGGCA 57.938 34.783 6.49 0.0 0.00 4.75
1018 3775 9.116067 CCTATTCCATGACGGATTTAAACTTAA 57.884 33.333 0.00 0.0 45.80 1.85
1810 8358 3.383505 TCTTCCTTCGATTCCTTATGCGA 59.616 43.478 0.00 0.0 0.00 5.10
1869 8425 6.755607 GGTCTTTATCCTCGTCGTATTCTTTT 59.244 38.462 0.00 0.0 0.00 2.27
1956 8512 5.516339 CACGAGAAATTGAACAAAAAGCTGT 59.484 36.000 0.00 0.0 0.00 4.40
2092 8716 4.592997 AGGAAGTCCCTTCTAAATTGGG 57.407 45.455 4.18 0.0 44.85 4.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
457 1093 6.509418 TGATTCTTTCCCAATAAACGAAGG 57.491 37.500 0.00 0.0 0.00 3.46
608 1244 3.117550 TGCATTGTATGGCCCAGAATAGT 60.118 43.478 0.00 0.0 0.00 2.12
1018 3775 6.817140 CCTACTAAAGGCACGAAAATAGAAGT 59.183 38.462 0.00 0.0 38.97 3.01
1869 8425 0.184933 CTGGCCCCGGATTTCCATAA 59.815 55.000 0.73 0.0 35.14 1.90
1956 8512 2.354510 CGCAAGAAATAGGCCAATTCGA 59.645 45.455 5.01 0.0 43.02 3.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.