Multiple sequence alignment - TraesCS3B01G185900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G185900 chr3B 100.000 2216 0 0 1 2216 201494556 201496771 0.000000e+00 4093
1 TraesCS3B01G185900 chr5D 97.790 2217 48 1 1 2216 6234695 6232479 0.000000e+00 3821
2 TraesCS3B01G185900 chr5D 98.689 2059 27 0 158 2216 483806066 483804008 0.000000e+00 3653
3 TraesCS3B01G185900 chr1D 97.566 2219 39 3 1 2216 254478543 254480749 0.000000e+00 3784
4 TraesCS3B01G185900 chr1D 97.403 2079 52 2 1 2079 180354191 180352115 0.000000e+00 3539
5 TraesCS3B01G185900 chr7A 94.072 2210 126 5 1 2210 352295257 352293053 0.000000e+00 3350
6 TraesCS3B01G185900 chr7A 98.406 251 4 0 147 397 691937713 691937963 2.020000e-120 442
7 TraesCS3B01G185900 chr7A 99.153 118 1 0 720 837 167576312 167576195 1.720000e-51 213
8 TraesCS3B01G185900 chr7A 93.506 77 4 1 628 703 60206879 60206955 1.800000e-21 113
9 TraesCS3B01G185900 chr6D 95.953 1804 67 5 413 2216 210723384 210721587 0.000000e+00 2922
10 TraesCS3B01G185900 chrUn 98.867 1589 18 0 251 1839 386523936 386522348 0.000000e+00 2835
11 TraesCS3B01G185900 chrUn 98.758 1369 16 1 597 1965 407031545 407032912 0.000000e+00 2433
12 TraesCS3B01G185900 chrUn 97.456 747 7 1 1 747 397677578 397678312 0.000000e+00 1264
13 TraesCS3B01G185900 chr2D 98.093 1311 25 0 906 2216 643855801 643857111 0.000000e+00 2283
14 TraesCS3B01G185900 chr1A 98.693 612 8 0 1 612 554444933 554444322 0.000000e+00 1086
15 TraesCS3B01G185900 chr7D 95.592 431 18 1 1 431 88617882 88617453 0.000000e+00 689


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G185900 chr3B 201494556 201496771 2215 False 4093 4093 100.000 1 2216 1 chr3B.!!$F1 2215
1 TraesCS3B01G185900 chr5D 6232479 6234695 2216 True 3821 3821 97.790 1 2216 1 chr5D.!!$R1 2215
2 TraesCS3B01G185900 chr5D 483804008 483806066 2058 True 3653 3653 98.689 158 2216 1 chr5D.!!$R2 2058
3 TraesCS3B01G185900 chr1D 254478543 254480749 2206 False 3784 3784 97.566 1 2216 1 chr1D.!!$F1 2215
4 TraesCS3B01G185900 chr1D 180352115 180354191 2076 True 3539 3539 97.403 1 2079 1 chr1D.!!$R1 2078
5 TraesCS3B01G185900 chr7A 352293053 352295257 2204 True 3350 3350 94.072 1 2210 1 chr7A.!!$R2 2209
6 TraesCS3B01G185900 chr6D 210721587 210723384 1797 True 2922 2922 95.953 413 2216 1 chr6D.!!$R1 1803
7 TraesCS3B01G185900 chrUn 386522348 386523936 1588 True 2835 2835 98.867 251 1839 1 chrUn.!!$R1 1588
8 TraesCS3B01G185900 chrUn 407031545 407032912 1367 False 2433 2433 98.758 597 1965 1 chrUn.!!$F2 1368
9 TraesCS3B01G185900 chrUn 397677578 397678312 734 False 1264 1264 97.456 1 747 1 chrUn.!!$F1 746
10 TraesCS3B01G185900 chr2D 643855801 643857111 1310 False 2283 2283 98.093 906 2216 1 chr2D.!!$F1 1310
11 TraesCS3B01G185900 chr1A 554444322 554444933 611 True 1086 1086 98.693 1 612 1 chr1A.!!$R1 611

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
248 261 0.32336 TAGGCACCTGAATTGGCACC 60.323 55.0 0.0 0.0 41.91 5.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1717 1760 0.396435 ACCTGCAGACGATTTGACCA 59.604 50.0 17.39 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 9.169592 CTCCGGTCTAAATTAAATCAACCTAAA 57.830 33.333 0.00 0.00 0.00 1.85
132 133 9.063615 ACACCTTAAAGTTCATAGAACGAAAAT 57.936 29.630 4.43 0.00 0.00 1.82
246 259 2.291475 TGATTAGGCACCTGAATTGGCA 60.291 45.455 0.00 0.00 41.91 4.92
248 261 0.323360 TAGGCACCTGAATTGGCACC 60.323 55.000 0.00 0.00 41.91 5.01
405 442 3.004106 ACGTGTAAACGAGTTGCTCTACT 59.996 43.478 13.54 0.00 36.85 2.57
977 1016 6.724893 TTCTTCCGGATCAATATCACTACA 57.275 37.500 4.15 0.00 33.41 2.74
985 1024 6.582636 GGATCAATATCACTACACAGTTCCA 58.417 40.000 0.00 0.00 33.41 3.53
1076 1115 0.321564 CATTGGTCGTTGAGGAGGCA 60.322 55.000 0.00 0.00 0.00 4.75
1467 1510 5.835113 TTTTCTTGCTCTTGCTACAGTTT 57.165 34.783 0.00 0.00 40.48 2.66
1473 1516 5.862924 TGCTCTTGCTACAGTTTAATGAC 57.137 39.130 0.00 0.00 40.48 3.06
1874 1917 4.485875 TCCCTAATAAAGCGGATACCTCA 58.514 43.478 0.00 0.00 0.00 3.86
1900 1943 3.791353 CCTGCTTGAACAAAACGAAAGAC 59.209 43.478 0.00 0.00 0.00 3.01
2022 2065 5.450965 GGTTCATTCATTTGGCCATAGACTG 60.451 44.000 6.09 9.75 0.00 3.51
2126 2170 1.611261 CCGTTCCCCTACTCCACCA 60.611 63.158 0.00 0.00 0.00 4.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
54 55 5.363868 TGGAACGATAGAGACTCCATTTCAT 59.636 40.000 0.00 0.00 41.38 2.57
269 306 3.584848 AGGAGAACAGTAGCCTGACAAAT 59.415 43.478 0.00 0.00 41.50 2.32
405 442 5.147767 TGATAAGGGCTATAGCTCAGTTCA 58.852 41.667 26.23 20.00 46.01 3.18
977 1016 7.781324 ATTTTAGGAAATGATGTGGAACTGT 57.219 32.000 0.00 0.00 33.98 3.55
1076 1115 8.820831 CAGTAGATATGGGTCCTTTGAGAATAT 58.179 37.037 0.00 0.00 0.00 1.28
1176 1217 5.505173 AGCGAATTATTTGGGATTGTGAG 57.495 39.130 0.00 0.00 0.00 3.51
1508 1551 8.504005 CGTTACAAAGAACTTCAGGACATTATT 58.496 33.333 0.00 0.00 0.00 1.40
1717 1760 0.396435 ACCTGCAGACGATTTGACCA 59.604 50.000 17.39 0.00 0.00 4.02
1874 1917 3.476552 TCGTTTTGTTCAAGCAGGATCT 58.523 40.909 0.00 0.00 0.00 2.75
1900 1943 9.864034 AAGACGTGCTTTTATTTATCGATAATG 57.136 29.630 18.18 2.96 31.11 1.90
2022 2065 3.914426 TGAGGAATCAAAGGTAGCTCC 57.086 47.619 0.00 0.00 0.00 4.70
2126 2170 1.061546 ATGGGGGCGTATCCGTATTT 58.938 50.000 0.00 0.00 36.15 1.40
2176 2220 6.127814 TGGAGTAGGTAAAACAGTACTGATCG 60.128 42.308 29.30 2.86 0.00 3.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.