Multiple sequence alignment - TraesCS3B01G185700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G185700 chr3B 100.000 2432 0 0 1 2432 201493390 201490959 0.000000e+00 4492
1 TraesCS3B01G185700 chr3B 97.861 187 4 0 2049 2235 49388534 49388720 8.390000e-85 324
2 TraesCS3B01G185700 chr3B 95.876 97 2 2 2274 2369 237300145 237300240 3.240000e-34 156
3 TraesCS3B01G185700 chr1A 98.972 2432 23 2 1 2432 554447559 554449988 0.000000e+00 4351
4 TraesCS3B01G185700 chr1D 98.310 2367 36 4 1 2365 254477385 254475021 0.000000e+00 4146
5 TraesCS3B01G185700 chr1D 97.319 2350 60 3 17 2365 180356024 180358371 0.000000e+00 3988
6 TraesCS3B01G185700 chr1D 96.412 2369 67 10 1 2365 244768865 244766511 0.000000e+00 3888
7 TraesCS3B01G185700 chr1D 96.196 2366 83 4 1 2365 244201677 244199318 0.000000e+00 3864
8 TraesCS3B01G185700 chr1D 98.050 1692 31 1 364 2055 290507190 290505501 0.000000e+00 2940
9 TraesCS3B01G185700 chr5D 98.225 2366 39 2 1 2365 6235514 6237877 0.000000e+00 4133
10 TraesCS3B01G185700 chr5D 98.496 2327 32 3 41 2365 503331258 503328933 0.000000e+00 4100
11 TraesCS3B01G185700 chr5D 100.000 70 0 0 2363 2432 6238001 6238070 1.960000e-26 130
12 TraesCS3B01G185700 chr2D 99.327 1783 12 0 650 2432 33929969 33931751 0.000000e+00 3227
13 TraesCS3B01G185700 chrUn 98.447 644 10 0 1 644 465171849 465171206 0.000000e+00 1134
14 TraesCS3B01G185700 chrUn 100.000 70 0 0 2363 2432 406224515 406224584 1.960000e-26 130
15 TraesCS3B01G185700 chrUn 100.000 70 0 0 2363 2432 432962594 432962663 1.960000e-26 130
16 TraesCS3B01G185700 chr7B 100.000 73 0 0 2360 2432 397633237 397633165 4.220000e-28 135


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G185700 chr3B 201490959 201493390 2431 True 4492.0 4492 100.0000 1 2432 1 chr3B.!!$R1 2431
1 TraesCS3B01G185700 chr1A 554447559 554449988 2429 False 4351.0 4351 98.9720 1 2432 1 chr1A.!!$F1 2431
2 TraesCS3B01G185700 chr1D 254475021 254477385 2364 True 4146.0 4146 98.3100 1 2365 1 chr1D.!!$R3 2364
3 TraesCS3B01G185700 chr1D 180356024 180358371 2347 False 3988.0 3988 97.3190 17 2365 1 chr1D.!!$F1 2348
4 TraesCS3B01G185700 chr1D 244766511 244768865 2354 True 3888.0 3888 96.4120 1 2365 1 chr1D.!!$R2 2364
5 TraesCS3B01G185700 chr1D 244199318 244201677 2359 True 3864.0 3864 96.1960 1 2365 1 chr1D.!!$R1 2364
6 TraesCS3B01G185700 chr1D 290505501 290507190 1689 True 2940.0 2940 98.0500 364 2055 1 chr1D.!!$R4 1691
7 TraesCS3B01G185700 chr5D 503328933 503331258 2325 True 4100.0 4100 98.4960 41 2365 1 chr5D.!!$R1 2324
8 TraesCS3B01G185700 chr5D 6235514 6238070 2556 False 2131.5 4133 99.1125 1 2432 2 chr5D.!!$F1 2431
9 TraesCS3B01G185700 chr2D 33929969 33931751 1782 False 3227.0 3227 99.3270 650 2432 1 chr2D.!!$F1 1782
10 TraesCS3B01G185700 chrUn 465171206 465171849 643 True 1134.0 1134 98.4470 1 644 1 chrUn.!!$R1 643

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
267 268 4.101119 TCACCGAGGAAAAGAGAGAAGTTT 59.899 41.667 0.0 0.0 0.0 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1872 1882 8.088463 AGAGATTCCCACCATATCATAAGATC 57.912 38.462 0.0 0.0 35.67 2.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
149 150 4.832823 TGGAAATCCAAAAGAAAGGGAGTC 59.167 41.667 0.00 0.00 44.35 3.36
267 268 4.101119 TCACCGAGGAAAAGAGAGAAGTTT 59.899 41.667 0.00 0.00 0.00 2.66
567 570 7.748241 CGTTTTTGTTGTTTTTGATGTGGAAAT 59.252 29.630 0.00 0.00 0.00 2.17
884 892 5.360714 CCCTTCTATACGGTACCAGTTGTTA 59.639 44.000 13.54 3.95 0.00 2.41
916 924 8.241497 TGAATTTGCTTCATTAATAGGCTCAT 57.759 30.769 0.00 0.00 38.97 2.90
1872 1882 0.793104 GCCGATTTTCAAGAACGCGG 60.793 55.000 12.47 0.00 40.17 6.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 5.533482 TCACTTTGTCTCACTTTCTCTAGC 58.467 41.667 0.00 0.0 0.00 3.42
149 150 3.759581 AGATTCATCCAATGGAATCCCG 58.240 45.455 5.89 0.0 46.69 5.14
267 268 8.312564 TCAATTCAGCATTGTCAATTTATCCAA 58.687 29.630 0.00 0.0 42.79 3.53
567 570 2.433239 GCCCAAGGGTATAGAAAGACGA 59.567 50.000 7.05 0.0 37.65 4.20
916 924 5.656480 TCCATAACGATCAAAGTCGAATCA 58.344 37.500 3.09 0.0 44.06 2.57
1872 1882 8.088463 AGAGATTCCCACCATATCATAAGATC 57.912 38.462 0.00 0.0 35.67 2.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.