Multiple sequence alignment - TraesCS3B01G184800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G184800 chr3B 100.000 2288 0 0 1 2288 200830102 200832389 0 4226
1 TraesCS3B01G184800 chr3B 99.015 1726 17 0 1 1726 200855011 200856736 0 3094
2 TraesCS3B01G184800 chr3B 98.587 566 8 0 1723 2288 200845547 200846112 0 1002
3 TraesCS3B01G184800 chr3B 98.233 566 10 0 1723 2288 200838685 200839250 0 990
4 TraesCS3B01G184800 chr1D 94.269 1710 96 1 1 1710 481925578 481927285 0 2614
5 TraesCS3B01G184800 chr5D 94.360 1702 88 3 9 1710 353957345 353959038 0 2604
6 TraesCS3B01G184800 chr5D 93.801 1710 101 2 1 1710 39089847 39091551 0 2566
7 TraesCS3B01G184800 chr2B 93.768 1717 104 2 1 1717 464671497 464673210 0 2575
8 TraesCS3B01G184800 chr7B 93.746 1711 102 4 4 1714 190121775 190120070 0 2562
9 TraesCS3B01G184800 chr7B 93.571 1711 105 4 1 1710 457414304 457416010 0 2545
10 TraesCS3B01G184800 chr4D 93.808 1712 90 7 1 1710 345354858 345356555 0 2560
11 TraesCS3B01G184800 chr5B 93.411 1715 109 3 1 1713 503240479 503238767 0 2538
12 TraesCS3B01G184800 chr5B 98.053 565 11 0 1723 2287 42214754 42214190 0 983
13 TraesCS3B01G184800 chr1B 97.699 565 13 0 1723 2287 581426871 581427435 0 972
14 TraesCS3B01G184800 chr1B 97.691 563 13 0 1725 2287 306856431 306855869 0 968
15 TraesCS3B01G184800 chr1B 97.522 565 14 0 1723 2287 40014583 40014019 0 966
16 TraesCS3B01G184800 chr1B 97.522 565 14 0 1723 2287 150809815 150810379 0 966
17 TraesCS3B01G184800 chr6A 97.522 565 14 0 1723 2287 198225613 198225049 0 966
18 TraesCS3B01G184800 chr5A 97.522 565 14 0 1723 2287 404789146 404788582 0 966


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G184800 chr3B 200830102 200832389 2287 False 4226 4226 100.000 1 2288 1 chr3B.!!$F1 2287
1 TraesCS3B01G184800 chr3B 200855011 200856736 1725 False 3094 3094 99.015 1 1726 1 chr3B.!!$F4 1725
2 TraesCS3B01G184800 chr3B 200845547 200846112 565 False 1002 1002 98.587 1723 2288 1 chr3B.!!$F3 565
3 TraesCS3B01G184800 chr3B 200838685 200839250 565 False 990 990 98.233 1723 2288 1 chr3B.!!$F2 565
4 TraesCS3B01G184800 chr1D 481925578 481927285 1707 False 2614 2614 94.269 1 1710 1 chr1D.!!$F1 1709
5 TraesCS3B01G184800 chr5D 353957345 353959038 1693 False 2604 2604 94.360 9 1710 1 chr5D.!!$F2 1701
6 TraesCS3B01G184800 chr5D 39089847 39091551 1704 False 2566 2566 93.801 1 1710 1 chr5D.!!$F1 1709
7 TraesCS3B01G184800 chr2B 464671497 464673210 1713 False 2575 2575 93.768 1 1717 1 chr2B.!!$F1 1716
8 TraesCS3B01G184800 chr7B 190120070 190121775 1705 True 2562 2562 93.746 4 1714 1 chr7B.!!$R1 1710
9 TraesCS3B01G184800 chr7B 457414304 457416010 1706 False 2545 2545 93.571 1 1710 1 chr7B.!!$F1 1709
10 TraesCS3B01G184800 chr4D 345354858 345356555 1697 False 2560 2560 93.808 1 1710 1 chr4D.!!$F1 1709
11 TraesCS3B01G184800 chr5B 503238767 503240479 1712 True 2538 2538 93.411 1 1713 1 chr5B.!!$R2 1712
12 TraesCS3B01G184800 chr5B 42214190 42214754 564 True 983 983 98.053 1723 2287 1 chr5B.!!$R1 564
13 TraesCS3B01G184800 chr1B 581426871 581427435 564 False 972 972 97.699 1723 2287 1 chr1B.!!$F2 564
14 TraesCS3B01G184800 chr1B 306855869 306856431 562 True 968 968 97.691 1725 2287 1 chr1B.!!$R2 562
15 TraesCS3B01G184800 chr1B 40014019 40014583 564 True 966 966 97.522 1723 2287 1 chr1B.!!$R1 564
16 TraesCS3B01G184800 chr1B 150809815 150810379 564 False 966 966 97.522 1723 2287 1 chr1B.!!$F1 564
17 TraesCS3B01G184800 chr6A 198225049 198225613 564 True 966 966 97.522 1723 2287 1 chr6A.!!$R1 564
18 TraesCS3B01G184800 chr5A 404788582 404789146 564 True 966 966 97.522 1723 2287 1 chr5A.!!$R1 564

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
575 576 0.121197 TGGGGAGGAGGAAGGTTGAT 59.879 55.0 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1754 1763 2.488087 AAGTCACTGCCGTACCTCGC 62.488 60.0 0.0 0.0 38.35 5.03 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
176 177 3.000819 TCCCCGTCAATGACCGCT 61.001 61.111 7.91 0.0 0.00 5.52
181 182 2.434185 GTCAATGACCGCTGGCGA 60.434 61.111 16.79 0.0 42.83 5.54
575 576 0.121197 TGGGGAGGAGGAAGGTTGAT 59.879 55.000 0.00 0.0 0.00 2.57
960 965 1.559682 GAGGATGGCCCAACTCACTTA 59.440 52.381 12.43 0.0 37.41 2.24
1338 1347 8.887717 ACTATCAAGTCTGCTTTGAACATATTC 58.112 33.333 0.00 0.0 31.49 1.75
1657 1666 1.544724 TTTGCATAGCCAGGTTGGAC 58.455 50.000 0.00 0.0 40.96 4.02
1754 1763 2.758979 AGTACGTATCCTTGTCACCCTG 59.241 50.000 0.00 0.0 0.00 4.45
2048 2057 3.709987 AGATGCATTTTATCCGCTTTGC 58.290 40.909 0.00 0.0 0.00 3.68
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
181 182 3.593794 GGGAGACGGCTATCGCGT 61.594 66.667 5.77 0.0 43.89 6.01
238 239 2.851195 AGAAGTGGTGCAAGTACAAGG 58.149 47.619 0.00 0.0 0.00 3.61
575 576 2.024846 CACCCCCTCTCTTCTCTCACTA 60.025 54.545 0.00 0.0 0.00 2.74
1008 1013 1.139058 ACGAAGTGCTTGGTGAAGTCT 59.861 47.619 0.00 0.0 42.51 3.24
1305 1313 3.017442 AGCAGACTTGATAGTACGCTCA 58.983 45.455 0.00 0.0 37.39 4.26
1338 1347 2.487762 ACAGTCCAACGCATAAACCATG 59.512 45.455 0.00 0.0 37.73 3.66
1657 1666 3.679980 CCCGCATTGAATATACTTCTCCG 59.320 47.826 0.00 0.0 0.00 4.63
1754 1763 2.488087 AAGTCACTGCCGTACCTCGC 62.488 60.000 0.00 0.0 38.35 5.03
2048 2057 3.706698 TCAGGATTGATAAGCTCGAACG 58.293 45.455 0.00 0.0 0.00 3.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.