Multiple sequence alignment - TraesCS3B01G184400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G184400 chr3B 100.000 2756 0 0 1 2756 199923186 199920431 0.000000e+00 5090
1 TraesCS3B01G184400 chr3B 98.621 2756 35 2 1 2756 199901671 199904423 0.000000e+00 4876
2 TraesCS3B01G184400 chr3B 98.585 2756 39 0 1 2756 199698386 199695631 0.000000e+00 4874
3 TraesCS3B01G184400 chr3B 93.762 2052 110 8 650 2692 772738072 772740114 0.000000e+00 3064
4 TraesCS3B01G184400 chr1D 94.550 2055 97 10 646 2692 478756716 478758763 0.000000e+00 3160
5 TraesCS3B01G184400 chr1D 93.369 2051 124 8 650 2692 214094340 214092294 0.000000e+00 3024
6 TraesCS3B01G184400 chr1D 92.135 267 19 2 1 266 5340732 5340467 2.590000e-100 375
7 TraesCS3B01G184400 chr1D 92.105 266 21 0 1 266 37477999 37478264 2.590000e-100 375
8 TraesCS3B01G184400 chr2D 94.388 2049 106 6 650 2692 53771623 53769578 0.000000e+00 3138
9 TraesCS3B01G184400 chr2D 93.902 2050 116 5 650 2692 60192833 60194880 0.000000e+00 3085
10 TraesCS3B01G184400 chr6D 93.902 2050 116 5 650 2692 97560229 97562276 0.000000e+00 3085
11 TraesCS3B01G184400 chr6D 93.827 81 4 1 2676 2756 428004682 428004603 1.340000e-23 121
12 TraesCS3B01G184400 chr3D 93.415 2050 125 6 650 2692 54819252 54821298 0.000000e+00 3029
13 TraesCS3B01G184400 chr5A 88.444 649 60 5 1 649 387705232 387704599 0.000000e+00 769
14 TraesCS3B01G184400 chr6B 85.782 633 68 9 1 621 323946319 323945697 0.000000e+00 651
15 TraesCS3B01G184400 chr6B 89.247 93 7 3 2664 2756 457694460 457694549 2.240000e-21 113
16 TraesCS3B01G184400 chr6A 85.632 522 63 7 100 619 515529693 515530204 3.120000e-149 538
17 TraesCS3B01G184400 chr6A 82.878 549 75 15 83 627 333810038 333810571 2.480000e-130 475
18 TraesCS3B01G184400 chr3A 94.141 256 14 1 1 256 159802685 159802431 3.330000e-104 388
19 TraesCS3B01G184400 chr3A 78.571 322 51 11 263 583 514955452 514955756 2.170000e-46 196
20 TraesCS3B01G184400 chr3A 78.261 322 53 10 263 583 487806529 487806834 1.010000e-44 191
21 TraesCS3B01G184400 chr4B 93.462 260 16 1 1 260 297663206 297662948 4.310000e-103 385
22 TraesCS3B01G184400 chr4B 82.632 190 23 7 432 621 86324195 86324016 2.840000e-35 159
23 TraesCS3B01G184400 chr4B 92.857 84 4 2 2674 2756 468453504 468453422 1.340000e-23 121
24 TraesCS3B01G184400 chr4D 90.000 100 4 6 2660 2756 386461279 386461183 1.040000e-24 124
25 TraesCS3B01G184400 chr1B 94.937 79 3 1 2678 2756 481506716 481506639 3.730000e-24 122
26 TraesCS3B01G184400 chr7D 93.902 82 2 3 2675 2756 453372985 453372907 1.340000e-23 121
27 TraesCS3B01G184400 chr5D 91.860 86 4 3 2673 2756 376886682 376886598 1.730000e-22 117


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G184400 chr3B 199920431 199923186 2755 True 5090 5090 100.000 1 2756 1 chr3B.!!$R2 2755
1 TraesCS3B01G184400 chr3B 199901671 199904423 2752 False 4876 4876 98.621 1 2756 1 chr3B.!!$F1 2755
2 TraesCS3B01G184400 chr3B 199695631 199698386 2755 True 4874 4874 98.585 1 2756 1 chr3B.!!$R1 2755
3 TraesCS3B01G184400 chr3B 772738072 772740114 2042 False 3064 3064 93.762 650 2692 1 chr3B.!!$F2 2042
4 TraesCS3B01G184400 chr1D 478756716 478758763 2047 False 3160 3160 94.550 646 2692 1 chr1D.!!$F2 2046
5 TraesCS3B01G184400 chr1D 214092294 214094340 2046 True 3024 3024 93.369 650 2692 1 chr1D.!!$R2 2042
6 TraesCS3B01G184400 chr2D 53769578 53771623 2045 True 3138 3138 94.388 650 2692 1 chr2D.!!$R1 2042
7 TraesCS3B01G184400 chr2D 60192833 60194880 2047 False 3085 3085 93.902 650 2692 1 chr2D.!!$F1 2042
8 TraesCS3B01G184400 chr6D 97560229 97562276 2047 False 3085 3085 93.902 650 2692 1 chr6D.!!$F1 2042
9 TraesCS3B01G184400 chr3D 54819252 54821298 2046 False 3029 3029 93.415 650 2692 1 chr3D.!!$F1 2042
10 TraesCS3B01G184400 chr5A 387704599 387705232 633 True 769 769 88.444 1 649 1 chr5A.!!$R1 648
11 TraesCS3B01G184400 chr6B 323945697 323946319 622 True 651 651 85.782 1 621 1 chr6B.!!$R1 620
12 TraesCS3B01G184400 chr6A 515529693 515530204 511 False 538 538 85.632 100 619 1 chr6A.!!$F2 519
13 TraesCS3B01G184400 chr6A 333810038 333810571 533 False 475 475 82.878 83 627 1 chr6A.!!$F1 544

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
896 915 2.356135 GCTAGATCCGCCTGTTTTTCA 58.644 47.619 0.0 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2497 2524 0.331616 ACCCAGAAAAGCGCCCTAAT 59.668 50.0 2.29 0.0 0.0 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
290 301 7.510549 TTGAGTTCAAGAGAAAATTAGGGTG 57.489 36.000 0.00 0.00 35.08 4.61
896 915 2.356135 GCTAGATCCGCCTGTTTTTCA 58.644 47.619 0.00 0.00 0.00 2.69
1028 1047 3.500642 CTCGAGCTCCGCTGTCGA 61.501 66.667 8.47 0.00 39.88 4.20
1810 1837 2.812358 TGTTGAAGAAGCTCAGCGTA 57.188 45.000 0.00 0.00 29.75 4.42
1979 2006 3.998913 TGGTGGTAGCATTTCTGATGA 57.001 42.857 0.00 0.00 0.00 2.92
2120 2147 1.667236 CGGTATGATTGCAAGGCTCA 58.333 50.000 4.94 4.30 0.00 4.26
2254 2281 0.107456 GATCCCGGATGCAGACATGT 59.893 55.000 4.08 0.00 36.35 3.21
2265 2292 4.799564 TGCAGACATGTAGTACATCACA 57.200 40.909 13.00 4.55 36.53 3.58
2497 2524 4.277174 CGAAGCTAGAAGAAGATGGAGCTA 59.723 45.833 0.00 0.00 39.28 3.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
4 5 3.247948 TCCGGTAATAGCCCTACATGA 57.752 47.619 0.00 0.0 0.00 3.07
290 301 0.110056 CTTCTGCATCACAACACGCC 60.110 55.000 0.00 0.0 0.00 5.68
896 915 0.394352 GTGATTCAGCCACGGGGAAT 60.394 55.000 8.67 0.0 35.59 3.01
1028 1047 3.171388 GGGGACTCCGGCCATGAT 61.171 66.667 2.24 0.0 0.00 2.45
1341 1367 4.615682 GCATGTAGCAAGTGCAACACATAA 60.616 41.667 14.11 0.0 45.16 1.90
1753 1780 2.955660 CAACAAAAGGGACAACTGGCTA 59.044 45.455 0.00 0.0 0.00 3.93
1810 1837 9.976511 CATCTTTGAGGCATATTCATTGTAAAT 57.023 29.630 0.00 0.0 0.00 1.40
1979 2006 1.338973 CACACTGATTTGTTGCAGCCT 59.661 47.619 0.00 0.0 35.57 4.58
2120 2147 5.183228 CGTCTTTGAGGTTAACACCCATAT 58.817 41.667 8.10 0.0 45.63 1.78
2497 2524 0.331616 ACCCAGAAAAGCGCCCTAAT 59.668 50.000 2.29 0.0 0.00 1.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.