Multiple sequence alignment - TraesCS3B01G183900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G183900 chr3B 100.000 2450 0 0 1 2450 195665361 195667810 0.000000e+00 4525
1 TraesCS3B01G183900 chr3B 94.483 2284 112 7 1 2273 288475200 288477480 0.000000e+00 3507
2 TraesCS3B01G183900 chr3B 89.593 2460 212 31 1 2433 331024944 331027386 0.000000e+00 3085
3 TraesCS3B01G183900 chr1B 98.203 2449 40 3 1 2448 287516454 287518899 0.000000e+00 4276
4 TraesCS3B01G183900 chr1B 90.443 2459 198 25 1 2433 200995202 200997649 0.000000e+00 3205
5 TraesCS3B01G183900 chr1B 89.724 2462 211 22 1 2433 387430129 387427681 0.000000e+00 3107
6 TraesCS3B01G183900 chr2B 95.311 2282 96 6 1 2273 762706218 762708497 0.000000e+00 3611
7 TraesCS3B01G183900 chr2B 95.238 294 13 1 2158 2450 545609926 545609633 4.770000e-127 464
8 TraesCS3B01G183900 chr2B 89.121 239 24 2 2212 2450 465449102 465448866 1.840000e-76 296
9 TraesCS3B01G183900 chr2A 91.038 2466 196 16 2 2450 267980584 267983041 0.000000e+00 3306
10 TraesCS3B01G183900 chr4B 92.128 2312 153 16 11 2302 534533200 534535502 0.000000e+00 3234
11 TraesCS3B01G183900 chr1D 90.049 2462 200 30 1 2433 246373124 246375569 0.000000e+00 3147


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G183900 chr3B 195665361 195667810 2449 False 4525 4525 100.000 1 2450 1 chr3B.!!$F1 2449
1 TraesCS3B01G183900 chr3B 288475200 288477480 2280 False 3507 3507 94.483 1 2273 1 chr3B.!!$F2 2272
2 TraesCS3B01G183900 chr3B 331024944 331027386 2442 False 3085 3085 89.593 1 2433 1 chr3B.!!$F3 2432
3 TraesCS3B01G183900 chr1B 287516454 287518899 2445 False 4276 4276 98.203 1 2448 1 chr1B.!!$F2 2447
4 TraesCS3B01G183900 chr1B 200995202 200997649 2447 False 3205 3205 90.443 1 2433 1 chr1B.!!$F1 2432
5 TraesCS3B01G183900 chr1B 387427681 387430129 2448 True 3107 3107 89.724 1 2433 1 chr1B.!!$R1 2432
6 TraesCS3B01G183900 chr2B 762706218 762708497 2279 False 3611 3611 95.311 1 2273 1 chr2B.!!$F1 2272
7 TraesCS3B01G183900 chr2A 267980584 267983041 2457 False 3306 3306 91.038 2 2450 1 chr2A.!!$F1 2448
8 TraesCS3B01G183900 chr4B 534533200 534535502 2302 False 3234 3234 92.128 11 2302 1 chr4B.!!$F1 2291
9 TraesCS3B01G183900 chr1D 246373124 246375569 2445 False 3147 3147 90.049 1 2433 1 chr1D.!!$F1 2432

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
218 219 1.269998 GCGTGGTTACTCTCACACTCT 59.730 52.381 0.00 0.0 33.83 3.24 F
784 791 3.603532 CAAGATAGCAAGTGCCTTGAGA 58.396 45.455 16.28 5.7 43.42 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1145 1153 1.726853 AAGCATAGAACTGGCACGAC 58.273 50.0 0.00 0.0 0.0 4.34 R
2342 2385 0.105593 GAGAGCATGATCCCGAGCAA 59.894 55.0 7.49 0.0 0.0 3.91 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
218 219 1.269998 GCGTGGTTACTCTCACACTCT 59.730 52.381 0.00 0.0 33.83 3.24
320 321 6.311445 CCGAATATGTCATATAGGAGCAACAC 59.689 42.308 16.58 0.0 0.00 3.32
662 669 8.931775 GGAAGAAGTAAAGAAGATTGAGAAGAC 58.068 37.037 0.00 0.0 0.00 3.01
784 791 3.603532 CAAGATAGCAAGTGCCTTGAGA 58.396 45.455 16.28 5.7 43.42 3.27
1102 1110 4.294347 TGGACATGATCATACACACCCTA 58.706 43.478 8.15 0.0 0.00 3.53
1152 1160 1.191647 CACAGTTACTTTCGTCGTGCC 59.808 52.381 0.00 0.0 0.00 5.01
1527 1540 5.301298 AGAAGCAAAAAGAGAAGAGTTGCAT 59.699 36.000 9.13 0.0 45.47 3.96
1607 1626 6.014242 TGACCCATTCTGAGTATATCATCCAC 60.014 42.308 0.00 0.0 37.28 4.02
2113 2136 0.039035 AATCGGGTTAGCTTGGGCAA 59.961 50.000 0.00 0.0 41.70 4.52
2282 2319 6.148811 TGTTCCTTTGGTGAGATCGATAAAAC 59.851 38.462 0.00 0.0 0.00 2.43
2283 2320 6.049955 TCCTTTGGTGAGATCGATAAAACT 57.950 37.500 0.00 0.0 0.00 2.66
2365 2408 2.744494 GCTCGGGATCATGCTCTCTTTT 60.744 50.000 0.00 0.0 0.00 2.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
218 219 4.142622 CGAAGCTCATGCCAAAACAATCTA 60.143 41.667 0.00 0.0 40.80 1.98
320 321 0.905357 AAACGGTGAGATCTCAGGGG 59.095 55.000 25.76 18.5 40.75 4.79
662 669 0.391661 AGTACTGCCAGCGTTGATGG 60.392 55.000 0.00 0.0 42.66 3.51
1102 1110 7.112122 TCACAAATGAGAGTAATGCCACTAAT 58.888 34.615 0.00 0.0 0.00 1.73
1145 1153 1.726853 AAGCATAGAACTGGCACGAC 58.273 50.000 0.00 0.0 0.00 4.34
1527 1540 3.005791 TCTCGCACAATCACTCTCTGAAA 59.994 43.478 0.00 0.0 30.60 2.69
1607 1626 9.961265 ATAACATTTGATTTCAGCATGTATCAG 57.039 29.630 0.00 0.0 38.62 2.90
2342 2385 0.105593 GAGAGCATGATCCCGAGCAA 59.894 55.000 7.49 0.0 0.00 3.91
2365 2408 2.079170 TGATTGTGCCAAAGGTTCCA 57.921 45.000 0.00 0.0 0.00 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.