Multiple sequence alignment - TraesCS3B01G180700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G180700 chr3B 100.000 2222 0 0 1 2222 188461657 188463878 0.000000e+00 4104
1 TraesCS3B01G180700 chr3B 98.828 1536 14 1 1 1532 188481611 188483146 0.000000e+00 2734
2 TraesCS3B01G180700 chr3B 93.913 805 44 3 736 1535 766099497 766100301 0.000000e+00 1210
3 TraesCS3B01G180700 chr3B 97.585 621 10 1 1607 2222 188491326 188491946 0.000000e+00 1059
4 TraesCS3B01G180700 chr3B 95.876 194 8 0 2025 2218 202591462 202591269 4.610000e-82 315
5 TraesCS3B01G180700 chr3B 77.078 397 74 13 1644 2030 50342936 50343325 1.730000e-51 213
6 TraesCS3B01G180700 chr3B 98.780 82 1 0 1532 1613 188486009 188486090 1.780000e-31 147
7 TraesCS3B01G180700 chr6A 94.634 1025 46 4 516 1535 613366592 613367612 0.000000e+00 1580
8 TraesCS3B01G180700 chr6A 96.354 192 7 0 2027 2218 228524255 228524064 1.280000e-82 316
9 TraesCS3B01G180700 chr2B 94.146 1025 51 6 516 1535 77333907 77334927 0.000000e+00 1552
10 TraesCS3B01G180700 chr2B 93.976 249 7 3 275 515 72934247 72933999 9.690000e-99 370
11 TraesCS3B01G180700 chr7B 93.854 1025 54 4 516 1535 228682439 228681419 0.000000e+00 1535
12 TraesCS3B01G180700 chr7B 94.378 249 6 3 275 515 715379105 715379353 2.080000e-100 375
13 TraesCS3B01G180700 chr7B 93.976 249 7 3 275 515 715382423 715382671 9.690000e-99 370
14 TraesCS3B01G180700 chr7B 93.600 250 8 3 275 516 551216354 551216105 1.250000e-97 366
15 TraesCS3B01G180700 chr7B 93.600 250 8 4 275 516 690099386 690099137 1.250000e-97 366
16 TraesCS3B01G180700 chr6D 93.470 1026 57 5 516 1535 15119337 15120358 0.000000e+00 1515
17 TraesCS3B01G180700 chr4D 93.463 1025 58 6 516 1535 386932372 386933392 0.000000e+00 1513
18 TraesCS3B01G180700 chr3A 92.585 1025 65 8 516 1535 55445818 55446836 0.000000e+00 1461
19 TraesCS3B01G180700 chr6B 91.237 1027 61 16 516 1535 171788720 171787716 0.000000e+00 1371
20 TraesCS3B01G180700 chr2A 93.657 268 10 3 5 267 605545539 605545804 5.750000e-106 394
21 TraesCS3B01G180700 chr4A 91.575 273 12 4 3 269 651097031 651096764 1.250000e-97 366
22 TraesCS3B01G180700 chr4A 93.574 249 8 3 275 515 695235781 695236029 4.510000e-97 364
23 TraesCS3B01G180700 chrUn 93.574 249 8 3 275 515 264232982 264233230 4.510000e-97 364
24 TraesCS3B01G180700 chrUn 96.373 193 7 0 2026 2218 342508105 342507913 3.560000e-83 318
25 TraesCS3B01G180700 chrUn 96.373 193 7 0 2026 2218 399642072 399642264 3.560000e-83 318
26 TraesCS3B01G180700 chrUn 95.876 194 8 0 2025 2218 382685504 382685697 4.610000e-82 315
27 TraesCS3B01G180700 chrUn 87.823 271 27 4 3 267 232542858 232543128 1.660000e-81 313
28 TraesCS3B01G180700 chrUn 87.085 271 29 4 3 267 389026079 389026349 3.590000e-78 302
29 TraesCS3B01G180700 chrUn 78.519 270 54 4 1763 2030 35686095 35685828 8.160000e-40 174
30 TraesCS3B01G180700 chr4B 93.281 253 8 4 275 518 36968674 36968422 4.510000e-97 364
31 TraesCS3B01G180700 chr4B 96.429 196 6 1 2027 2222 613037723 613037917 2.750000e-84 322
32 TraesCS3B01G180700 chr5B 97.449 196 5 0 2027 2222 418373356 418373161 3.540000e-88 335
33 TraesCS3B01G180700 chr5B 95.876 194 8 0 2025 2218 430264793 430264986 4.610000e-82 315


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G180700 chr3B 188461657 188463878 2221 False 4104.0 4104 100.000 1 2222 1 chr3B.!!$F2 2221
1 TraesCS3B01G180700 chr3B 188481611 188486090 4479 False 1440.5 2734 98.804 1 1613 2 chr3B.!!$F5 1612
2 TraesCS3B01G180700 chr3B 766099497 766100301 804 False 1210.0 1210 93.913 736 1535 1 chr3B.!!$F4 799
3 TraesCS3B01G180700 chr3B 188491326 188491946 620 False 1059.0 1059 97.585 1607 2222 1 chr3B.!!$F3 615
4 TraesCS3B01G180700 chr6A 613366592 613367612 1020 False 1580.0 1580 94.634 516 1535 1 chr6A.!!$F1 1019
5 TraesCS3B01G180700 chr2B 77333907 77334927 1020 False 1552.0 1552 94.146 516 1535 1 chr2B.!!$F1 1019
6 TraesCS3B01G180700 chr7B 228681419 228682439 1020 True 1535.0 1535 93.854 516 1535 1 chr7B.!!$R1 1019
7 TraesCS3B01G180700 chr7B 715379105 715382671 3566 False 372.5 375 94.177 275 515 2 chr7B.!!$F1 240
8 TraesCS3B01G180700 chr6D 15119337 15120358 1021 False 1515.0 1515 93.470 516 1535 1 chr6D.!!$F1 1019
9 TraesCS3B01G180700 chr4D 386932372 386933392 1020 False 1513.0 1513 93.463 516 1535 1 chr4D.!!$F1 1019
10 TraesCS3B01G180700 chr3A 55445818 55446836 1018 False 1461.0 1461 92.585 516 1535 1 chr3A.!!$F1 1019
11 TraesCS3B01G180700 chr6B 171787716 171788720 1004 True 1371.0 1371 91.237 516 1535 1 chr6B.!!$R1 1019

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
971 1596 2.330254 CCAAAGAGGCAGCGAACAA 58.67 52.632 0.0 0.0 0.0 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1848 6984 0.590195 CCGCTATCAAATGAGCAGCC 59.41 55.0 11.86 0.0 38.69 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
971 1596 2.330254 CCAAAGAGGCAGCGAACAA 58.670 52.632 0.00 0.00 0.00 2.83
1038 1708 3.016031 TGCTTTCAAGACAACTGAGCAA 58.984 40.909 0.00 0.00 0.00 3.91
1351 3621 3.888323 TGCCACACACTGTTTATGTCAAT 59.112 39.130 0.00 0.00 0.00 2.57
1497 3768 3.463533 TGTATGACCATTTGCGTTTCG 57.536 42.857 0.00 0.00 0.00 3.46
1519 3790 9.935682 TTTCGTGATGCATTTCTAGAATATTTC 57.064 29.630 5.89 1.62 0.00 2.17
1561 6697 6.058833 TGCCGTCAAGCCATCTTATATTTTA 58.941 36.000 0.00 0.00 0.00 1.52
1674 6810 3.478274 CTGCTCCTCCCCCTGCTC 61.478 72.222 0.00 0.00 0.00 4.26
1848 6984 1.066908 ACAACATTTGGGCACGAACAG 59.933 47.619 0.00 0.00 34.12 3.16
1933 7069 0.253044 TGCAAGAGGTATGGTCAGCC 59.747 55.000 0.00 0.00 0.00 4.85
1985 7121 3.500680 TCCATCTTTACGCCAACACTTTC 59.499 43.478 0.00 0.00 0.00 2.62
2009 7145 5.979288 TCTATATTTCCCTCTTCTACGGC 57.021 43.478 0.00 0.00 0.00 5.68
2012 7148 3.545366 ATTTCCCTCTTCTACGGCTTC 57.455 47.619 0.00 0.00 0.00 3.86
2025 7161 1.024271 CGGCTTCAATGTACCCATGG 58.976 55.000 4.14 4.14 0.00 3.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
348 353 0.770557 ACTAAAGGGGTGGTGGCAGA 60.771 55.000 0.00 0.00 0.00 4.26
1038 1708 5.074804 GTGGTAACCTTTGGTAGTGGAATT 58.925 41.667 0.00 0.00 33.12 2.17
1674 6810 3.292481 AACATGCAGCAGGGGGAGG 62.292 63.158 12.54 0.00 0.00 4.30
1848 6984 0.590195 CCGCTATCAAATGAGCAGCC 59.410 55.000 11.86 0.00 38.69 4.85
1911 7047 2.012673 CTGACCATACCTCTTGCAAGC 58.987 52.381 21.99 4.84 0.00 4.01
1933 7069 2.852495 ATTAGCAGTCGTGGTGGGCG 62.852 60.000 0.00 0.00 35.51 6.13
1985 7121 6.209788 AGCCGTAGAAGAGGGAAATATAGAAG 59.790 42.308 0.00 0.00 34.80 2.85
2009 7145 3.652057 ACTCCCATGGGTACATTGAAG 57.348 47.619 30.28 19.16 34.35 3.02
2012 7148 5.451798 GCAATTTACTCCCATGGGTACATTG 60.452 44.000 30.28 26.17 38.27 2.82
2025 7161 3.367395 GGTGGCTTTCAGCAATTTACTCC 60.367 47.826 0.00 0.00 44.75 3.85
2116 7252 4.705023 AGTGCTTTTTGTTACTCACTTGGT 59.295 37.500 0.00 0.00 31.51 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.