Multiple sequence alignment - TraesCS3B01G178900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G178900 chr3B 100.000 3344 0 0 1 3344 184964860 184961517 0.000000e+00 6176.0
1 TraesCS3B01G178900 chr3B 98.598 3353 36 5 1 3344 186096696 186093346 0.000000e+00 5921.0
2 TraesCS3B01G178900 chr3B 82.520 1270 188 17 1611 2852 248248685 248249948 0.000000e+00 1085.0
3 TraesCS3B01G178900 chr3B 83.261 920 147 4 1934 2852 248580937 248581850 0.000000e+00 839.0
4 TraesCS3B01G178900 chr3B 85.246 244 30 4 1611 1851 248580489 248580729 2.580000e-61 246.0
5 TraesCS3B01G178900 chr3B 81.991 211 27 9 8 214 66680386 66680183 5.740000e-38 169.0
6 TraesCS3B01G178900 chr3B 81.043 211 30 7 8 214 66609009 66609213 3.450000e-35 159.0
7 TraesCS3B01G178900 chr3D 92.637 1657 105 12 1584 3233 553426932 553425286 0.000000e+00 2368.0
8 TraesCS3B01G178900 chr3D 82.609 207 31 4 8 212 42841226 42841023 9.530000e-41 178.0
9 TraesCS3B01G178900 chr3D 90.179 112 7 2 3233 3344 553424278 553424171 3.480000e-30 143.0
10 TraesCS3B01G178900 chr3D 94.286 70 2 2 563 631 175663782 175663850 4.560000e-19 106.0
11 TraesCS3B01G178900 chr3D 89.333 75 2 3 1240 1314 553427188 553427120 4.600000e-14 89.8
12 TraesCS3B01G178900 chr3A 90.166 966 65 17 2318 3272 690024276 690023330 0.000000e+00 1230.0
13 TraesCS3B01G178900 chr3A 93.497 692 39 5 1584 2273 690024961 690024274 0.000000e+00 1024.0
14 TraesCS3B01G178900 chr3A 82.133 375 34 14 839 1198 690025607 690025251 1.170000e-74 291.0
15 TraesCS3B01G178900 chr3A 85.976 164 17 6 61 221 54862934 54862774 1.600000e-38 171.0
16 TraesCS3B01G178900 chr2B 82.121 330 48 9 238 560 198718613 198718938 4.250000e-69 272.0
17 TraesCS3B01G178900 chr2B 83.607 183 23 6 38 215 198718363 198718543 7.420000e-37 165.0
18 TraesCS3B01G178900 chr4B 81.024 332 50 13 238 560 96289535 96289862 5.540000e-63 252.0
19 TraesCS3B01G178900 chr4D 77.522 347 66 11 221 560 230936144 230936485 7.320000e-47 198.0
20 TraesCS3B01G178900 chr4A 78.171 339 50 20 240 560 119096279 119095947 9.470000e-46 195.0
21 TraesCS3B01G178900 chr6B 85.638 188 20 5 38 223 172637648 172637830 1.220000e-44 191.0
22 TraesCS3B01G178900 chr6D 82.778 180 24 6 38 215 304269185 304269359 1.610000e-33 154.0
23 TraesCS3B01G178900 chr6D 94.366 71 3 1 563 633 172013029 172012960 1.270000e-19 108.0
24 TraesCS3B01G178900 chr2D 80.093 216 30 8 14 223 388520549 388520341 7.480000e-32 148.0
25 TraesCS3B01G178900 chr2D 75.075 333 59 16 238 550 445382404 445382732 2.090000e-27 134.0
26 TraesCS3B01G178900 chr1D 94.366 71 4 0 563 633 203264936 203264866 3.530000e-20 110.0
27 TraesCS3B01G178900 chr5D 91.250 80 5 2 555 633 375170841 375170919 1.270000e-19 108.0
28 TraesCS3B01G178900 chrUn 91.892 74 6 0 563 636 89803051 89802978 1.640000e-18 104.0
29 TraesCS3B01G178900 chr7D 93.056 72 3 2 563 633 58135021 58135091 1.640000e-18 104.0
30 TraesCS3B01G178900 chr7A 91.892 74 6 0 563 636 17210369 17210296 1.640000e-18 104.0
31 TraesCS3B01G178900 chr6A 90.000 80 6 2 555 633 78477159 78477081 5.900000e-18 102.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G178900 chr3B 184961517 184964860 3343 True 6176.000000 6176 100.000000 1 3344 1 chr3B.!!$R2 3343
1 TraesCS3B01G178900 chr3B 186093346 186096696 3350 True 5921.000000 5921 98.598000 1 3344 1 chr3B.!!$R3 3343
2 TraesCS3B01G178900 chr3B 248248685 248249948 1263 False 1085.000000 1085 82.520000 1611 2852 1 chr3B.!!$F2 1241
3 TraesCS3B01G178900 chr3B 248580489 248581850 1361 False 542.500000 839 84.253500 1611 2852 2 chr3B.!!$F3 1241
4 TraesCS3B01G178900 chr3D 553424171 553427188 3017 True 866.933333 2368 90.716333 1240 3344 3 chr3D.!!$R2 2104
5 TraesCS3B01G178900 chr3A 690023330 690025607 2277 True 848.333333 1230 88.598667 839 3272 3 chr3A.!!$R2 2433
6 TraesCS3B01G178900 chr2B 198718363 198718938 575 False 218.500000 272 82.864000 38 560 2 chr2B.!!$F1 522

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
395 450 1.168714 GGTTCCTACAAGGCTTGCTG 58.831 55.0 26.45 18.17 34.61 4.41 F
567 623 2.168458 TCCGGGATGTGATAACCAGA 57.832 50.0 0.00 0.00 0.00 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2254 2451 0.535102 AGCAACGTTTCCCTCCAGTG 60.535 55.000 0.0 0.0 0.0 3.66 R
2763 2966 6.699642 AGTTCAAACACACATAAATTTTCCCG 59.300 34.615 0.0 0.0 0.0 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
395 450 1.168714 GGTTCCTACAAGGCTTGCTG 58.831 55.000 26.45 18.17 34.61 4.41
499 555 4.691216 GGCAATCATCGGTATTTCCTAGAC 59.309 45.833 0.00 0.00 0.00 2.59
501 557 5.934625 GCAATCATCGGTATTTCCTAGACAT 59.065 40.000 0.00 0.00 0.00 3.06
567 623 2.168458 TCCGGGATGTGATAACCAGA 57.832 50.000 0.00 0.00 0.00 3.86
636 692 3.276846 ACAGGTTGGTTCGCGCAC 61.277 61.111 8.75 0.00 0.00 5.34
901 957 2.364647 CCAGTAAGAACCCTACCCGATC 59.635 54.545 0.00 0.00 0.00 3.69
2254 2451 4.137543 CACTATTAATGGTGAAGAGGGCC 58.862 47.826 23.46 0.00 41.19 5.80
2763 2966 0.106519 AGATACCTTGGGCCATGCAC 60.107 55.000 7.26 1.44 0.00 4.57
2990 3194 0.958822 CGGGGCACTTAAACAAGCTT 59.041 50.000 0.00 0.00 0.00 3.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
345 399 7.550196 CCATTGAAATATTGTGGGGAAAAAGAG 59.450 37.037 0.00 0.00 0.00 2.85
395 450 3.306019 CCAAATGCAACTAGTGAAACCCC 60.306 47.826 0.00 0.00 37.80 4.95
636 692 5.353123 TCTTACTAACTAGCAAAAATGCCCG 59.647 40.000 0.00 0.00 34.90 6.13
734 790 8.911918 TTAGAGGAACAATGCTACACTTTTTA 57.088 30.769 0.00 0.00 0.00 1.52
901 957 5.184479 TGAGCTTCAGGATTTCAGGAAATTG 59.816 40.000 8.53 4.79 40.77 2.32
1233 1303 2.477375 CACACGCACCAAATTACGTACT 59.523 45.455 0.00 0.00 36.91 2.73
2254 2451 0.535102 AGCAACGTTTCCCTCCAGTG 60.535 55.000 0.00 0.00 0.00 3.66
2763 2966 6.699642 AGTTCAAACACACATAAATTTTCCCG 59.300 34.615 0.00 0.00 0.00 5.14
2990 3194 5.913137 ACAACAGGAAAAACATGAACAGA 57.087 34.783 0.00 0.00 34.19 3.41
3122 3341 9.224267 GCTACATAATCCAACAGATGACATAAT 57.776 33.333 0.00 0.00 34.56 1.28


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.