AutoCloner

Multiple sequence alignment - TraesCS3B01G165100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS3B01G165100	chr3B	100.000	2540	0	0	1	2540	163152605	163155144	0.000000e+00	4691.0
1	TraesCS3B01G165100	chr3B	81.720	93	15	2	2335	2426	96959932	96960023	2.710000e-10	76.8
2	TraesCS3B01G165100	chr3D	87.491	1383	83	47	252	1591	112332222	112333557	0.000000e+00	1513.0
3	TraesCS3B01G165100	chr3D	90.772	596	25	16	1587	2161	112333599	112334185	0.000000e+00	769.0
4	TraesCS3B01G165100	chr3D	84.615	338	44	8	2196	2527	112349289	112349624	1.880000e-86	329.0
5	TraesCS3B01G165100	chr3D	79.464	224	44	2	2203	2426	152169021	152169242	9.410000e-35	158.0
6	TraesCS3B01G165100	chr3D	78.733	221	38	8	2192	2409	110218735	110218521	3.410000e-29	139.0
7	TraesCS3B01G165100	chr3A	83.387	1252	97	49	380	1572	107974626	107975825	0.000000e+00	1057.0
8	TraesCS3B01G165100	chr3A	81.414	764	71	43	1836	2540	107976123	107976874	2.210000e-155	558.0
9	TraesCS3B01G165100	chr3A	89.744	117	6	3	1587	1698	107975878	107975993	7.320000e-31	145.0
10	TraesCS3B01G165100	chr3A	79.747	158	24	7	2247	2400	639150944	639150791	9.610000e-20	108.0
11	TraesCS3B01G165100	chr5B	99.603	252	1	0	1	252	286879414	286879665	6.400000e-126	460.0
12	TraesCS3B01G165100	chr1B	96.838	253	7	1	1	252	666990247	666990499	3.020000e-114	422.0
13	TraesCS3B01G165100	chr1B	96.443	253	8	1	1	252	666989827	666990079	1.410000e-112	416.0
14	TraesCS3B01G165100	chr1B	90.446	157	14	1	105	260	596046676	596046520	3.310000e-49	206.0
15	TraesCS3B01G165100	chr5A	92.188	256	18	2	1	255	234922198	234921944	6.680000e-96	361.0
16	TraesCS3B01G165100	chr2B	91.946	149	11	1	105	252	422238691	422238839	9.210000e-50	207.0
17	TraesCS3B01G165100	chr2D	90.323	155	14	1	105	258	393203349	393203195	4.280000e-48	202.0
18	TraesCS3B01G165100	chr7D	83.028	218	29	6	2213	2426	22652427	22652640	9.270000e-45	191.0
19	TraesCS3B01G165100	chr1D	78.075	187	31	8	2216	2400	482528169	482527991	2.670000e-20	110.0
20	TraesCS3B01G165100	chr7A	79.054	148	29	2	2280	2426	109433680	109433826	1.610000e-17	100.0
21	TraesCS3B01G165100	chr5D	75.385	260	37	13	1	257	498379548	498379783	1.610000e-17	100.0
22	TraesCS3B01G165100	chr5D	81.203	133	18	4	2234	2365	519795780	519795906	1.610000e-17	100.0
23	TraesCS3B01G165100	chr1A	77.358	159	23	7	103	259	387224661	387224514	5.820000e-12	82.4

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS3B01G165100	chr3B	163152605	163155144	2539	False	4691.000000	4691	100.000000	1	2540	1	chr3B.!!$F2	2539
1	TraesCS3B01G165100	chr3D	112332222	112334185	1963	False	1141.000000	1513	89.131500	252	2161	2	chr3D.!!$F3	1909
2	TraesCS3B01G165100	chr3A	107974626	107976874	2248	False	586.666667	1057	84.848333	380	2540	3	chr3A.!!$F1	2160
3	TraesCS3B01G165100	chr1B	666989827	666990499	672	False	419.000000	422	96.640500	1	252	2	chr1B.!!$F1	251

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
704	1166	0.03601	CCGTCAGGCTCCAGAAACAT	60.036	55.0	0.0	0.0	0.0	2.71	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1951	2565	0.24691	GGAAGGAACTCTCGGTGGAC	59.753	60.0	0.0	0.0	38.49	4.02	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
225	647	2.267192	GGGATTAGACCCCTGGGATAC	58.733	57.143	16.20	4.97	43.81	2.24
252	674	3.829601	CCATTACAACCAAACAAGGCCTA	59.170	43.478	5.16	0.00	0.00	3.93
253	675	4.282195	CCATTACAACCAAACAAGGCCTAA	59.718	41.667	5.16	0.00	0.00	2.69
254	676	5.469479	CATTACAACCAAACAAGGCCTAAG	58.531	41.667	5.16	4.24	0.00	2.18
255	677	3.306472	ACAACCAAACAAGGCCTAAGA	57.694	42.857	5.16	0.00	0.00	2.10
256	678	3.222603	ACAACCAAACAAGGCCTAAGAG	58.777	45.455	5.16	0.00	0.00	2.85
274	696	3.462678	GTCGGGTCCCTCCTGCTC	61.463	72.222	6.29	0.00	42.13	4.26
300	722	6.846325	GCAAAGGAGCGAAATAATACTAGT	57.154	37.500	0.00	0.00	0.00	2.57
301	723	7.941795	GCAAAGGAGCGAAATAATACTAGTA	57.058	36.000	4.77	4.77	0.00	1.82
302	724	7.785144	GCAAAGGAGCGAAATAATACTAGTAC	58.215	38.462	4.31	0.00	0.00	2.73
303	725	7.437267	GCAAAGGAGCGAAATAATACTAGTACA	59.563	37.037	4.31	0.00	0.00	2.90
308	730	8.562892	GGAGCGAAATAATACTAGTACAGTACA	58.437	37.037	13.37	0.00	42.56	2.90
317	739	5.209818	ACTAGTACAGTACAAGCAAGCAA	57.790	39.130	13.37	0.00	34.98	3.91
326	748	1.289276	CAAGCAAGCAAAGCCGTTTT	58.711	45.000	0.00	0.00	0.00	2.43
358	780	1.754234	GGCCGTGGGAGCAATTGAT	60.754	57.895	10.34	1.34	0.00	2.57
359	781	1.322538	GGCCGTGGGAGCAATTGATT	61.323	55.000	10.34	0.00	0.00	2.57
360	782	0.532115	GCCGTGGGAGCAATTGATTT	59.468	50.000	10.34	0.00	0.00	2.17
361	783	1.736696	GCCGTGGGAGCAATTGATTTG	60.737	52.381	10.34	0.00	38.43	2.32
362	784	1.818060	CCGTGGGAGCAATTGATTTGA	59.182	47.619	10.34	0.00	37.53	2.69
363	785	2.415893	CCGTGGGAGCAATTGATTTGAC	60.416	50.000	10.34	0.00	37.53	3.18
365	787	1.818060	TGGGAGCAATTGATTTGACGG	59.182	47.619	10.34	0.00	37.53	4.79
367	789	2.159379	GGGAGCAATTGATTTGACGGAC	60.159	50.000	10.34	0.00	37.53	4.79
368	790	2.487762	GGAGCAATTGATTTGACGGACA	59.512	45.455	10.34	0.00	37.53	4.02
369	791	3.426695	GGAGCAATTGATTTGACGGACAG	60.427	47.826	10.34	0.00	37.53	3.51
371	793	2.351641	GCAATTGATTTGACGGACAGCA	60.352	45.455	10.34	0.00	37.53	4.41

Showing 1 to 25 of 107 entries

Previous1 2 3 4 5Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
110	532	1.893786	CAGAGGGGAGGAGTTCACG	59.106	63.158	0.00	0.00	0.00	4.35
178	600	2.590821	GGGGATTTCCATGGTCATCTG	58.409	52.381	12.58	0.00	37.91	2.90
225	647	4.262420	CCTTGTTTGGTTGTAATGGGGAAG	60.262	45.833	0.00	0.00	0.00	3.46
296	718	5.389935	GCTTTGCTTGCTTGTACTGTACTAG	60.390	44.000	20.32	20.32	35.16	2.57
297	719	4.451096	GCTTTGCTTGCTTGTACTGTACTA	59.549	41.667	17.98	10.30	0.00	1.82
298	720	3.251004	GCTTTGCTTGCTTGTACTGTACT	59.749	43.478	17.98	0.00	0.00	2.73
299	721	3.555518	GCTTTGCTTGCTTGTACTGTAC	58.444	45.455	10.98	10.98	0.00	2.90
300	722	2.552315	GGCTTTGCTTGCTTGTACTGTA	59.448	45.455	0.00	0.00	0.00	2.74
301	723	1.338020	GGCTTTGCTTGCTTGTACTGT	59.662	47.619	0.00	0.00	0.00	3.55
302	724	1.664016	CGGCTTTGCTTGCTTGTACTG	60.664	52.381	0.00	0.00	0.00	2.74
303	725	0.593128	CGGCTTTGCTTGCTTGTACT	59.407	50.000	0.00	0.00	0.00	2.73
308	730	1.289276	CAAAACGGCTTTGCTTGCTT	58.711	45.000	0.05	0.00	38.17	3.91
326	748	4.329545	GGCCTCACCTTCACCGCA	62.330	66.667	0.00	0.00	34.51	5.69
352	774	3.317711	TGTTGCTGTCCGTCAAATCAATT	59.682	39.130	0.00	0.00	0.00	2.32
358	780	1.433053	CCGTGTTGCTGTCCGTCAAA	61.433	55.000	0.00	0.00	0.00	2.69
359	781	1.885388	CCGTGTTGCTGTCCGTCAA	60.885	57.895	0.00	0.00	0.00	3.18
360	782	2.094757	ATCCGTGTTGCTGTCCGTCA	62.095	55.000	0.00	0.00	0.00	4.35
361	783	1.374252	ATCCGTGTTGCTGTCCGTC	60.374	57.895	0.00	0.00	0.00	4.79
362	784	1.667830	CATCCGTGTTGCTGTCCGT	60.668	57.895	0.00	0.00	0.00	4.69
363	785	2.390599	CCATCCGTGTTGCTGTCCG	61.391	63.158	0.00	0.00	0.00	4.79
365	787	1.803334	TTACCATCCGTGTTGCTGTC	58.197	50.000	0.00	0.00	0.00	3.51
367	789	3.634568	TTTTTACCATCCGTGTTGCTG	57.365	42.857	0.00	0.00	0.00	4.41
401	825	2.435693	CCAGGCCGACTAGGAAGGG	61.436	68.421	0.00	0.00	45.00	3.95
406	832	0.395862	TCTTCTCCAGGCCGACTAGG	60.396	60.000	0.00	0.00	44.97	3.02
490	918	0.811616	GACCACCAGATCCATGCGTC	60.812	60.000	0.00	0.00	0.00	5.19

Showing 1 to 25 of 93 entries

Previous1 2 3 4Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.