Multiple sequence alignment - TraesCS3B01G146100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G146100 chr3B 100.000 3234 0 0 1 3234 135710387 135713620 0.000000e+00 5973.0
1 TraesCS3B01G146100 chr3B 97.699 1956 33 5 503 2449 135768305 135770257 0.000000e+00 3352.0
2 TraesCS3B01G146100 chr3B 97.651 1362 25 4 1090 2449 135813886 135815242 0.000000e+00 2331.0
3 TraesCS3B01G146100 chr3B 99.177 1094 8 1 1 1094 135807328 135808420 0.000000e+00 1969.0
4 TraesCS3B01G146100 chr3B 91.321 795 55 6 2452 3234 526044178 526044970 0.000000e+00 1074.0
5 TraesCS3B01G146100 chr3B 94.919 433 13 3 1 424 135749560 135749992 0.000000e+00 669.0
6 TraesCS3B01G146100 chr3B 96.078 102 4 0 414 515 135750382 135750483 2.000000e-37 167.0
7 TraesCS3B01G146100 chr3D 94.302 1948 67 14 522 2449 85826528 85828451 0.000000e+00 2942.0
8 TraesCS3B01G146100 chr3D 93.041 776 33 6 2472 3234 614651288 614652055 0.000000e+00 1114.0
9 TraesCS3B01G146100 chr3D 91.864 381 12 5 61 424 85825644 85826022 6.190000e-142 514.0
10 TraesCS3B01G146100 chr3D 96.396 111 4 0 414 524 85826392 85826502 1.980000e-42 183.0
11 TraesCS3B01G146100 chr3D 95.775 71 2 1 1 70 85588825 85588895 2.640000e-21 113.0
12 TraesCS3B01G146100 chr3D 89.855 69 6 1 2153 2221 2399097 2399030 1.600000e-13 87.9
13 TraesCS3B01G146100 chr3A 94.475 905 28 8 897 1800 102435841 102436724 0.000000e+00 1375.0
14 TraesCS3B01G146100 chr3A 93.923 905 33 9 897 1800 102388566 102389449 0.000000e+00 1347.0
15 TraesCS3B01G146100 chr3A 91.803 671 35 9 1789 2446 102389230 102389893 0.000000e+00 917.0
16 TraesCS3B01G146100 chr3A 94.737 437 17 3 1789 2221 102436500 102436934 0.000000e+00 675.0
17 TraesCS3B01G146100 chr3A 94.737 437 17 3 1789 2221 102491450 102491884 0.000000e+00 675.0
18 TraesCS3B01G146100 chr3A 92.045 264 12 6 611 874 102435382 102435636 2.370000e-96 363.0
19 TraesCS3B01G146100 chr3A 93.534 232 12 2 2220 2449 102437144 102437374 3.090000e-90 342.0
20 TraesCS3B01G146100 chr3A 91.700 253 12 6 611 863 102490151 102490394 3.090000e-90 342.0
21 TraesCS3B01G146100 chr3A 93.534 232 12 2 2220 2449 102492094 102492324 3.090000e-90 342.0
22 TraesCS3B01G146100 chr3A 90.000 140 9 2 733 872 102388350 102388484 3.320000e-40 176.0
23 TraesCS3B01G146100 chr3A 96.000 100 4 0 325 424 746909240 746909339 2.580000e-36 163.0
24 TraesCS3B01G146100 chr3A 89.394 66 5 2 1 65 102361150 102361214 7.440000e-12 82.4
25 TraesCS3B01G146100 chr3A 87.324 71 1 2 1 70 102474843 102474906 1.240000e-09 75.0
26 TraesCS3B01G146100 chr3A 87.324 71 1 2 1 70 102525681 102525744 1.240000e-09 75.0
27 TraesCS3B01G146100 chr2D 93.925 823 50 0 976 1798 393204782 393205604 0.000000e+00 1243.0
28 TraesCS3B01G146100 chr2D 93.412 759 50 0 1040 1798 393069612 393070370 0.000000e+00 1125.0
29 TraesCS3B01G146100 chr2D 91.771 802 37 11 2445 3234 409582892 409583676 0.000000e+00 1088.0
30 TraesCS3B01G146100 chr2D 84.861 251 34 4 70 316 640979456 640979206 1.930000e-62 250.0
31 TraesCS3B01G146100 chr2D 89.000 100 11 0 325 424 412634223 412634322 1.220000e-24 124.0
32 TraesCS3B01G146100 chr1D 92.822 822 56 1 977 1798 113994937 113994119 0.000000e+00 1188.0
33 TraesCS3B01G146100 chr6D 93.528 788 42 4 2449 3234 428947472 428946692 0.000000e+00 1164.0
34 TraesCS3B01G146100 chr6D 92.919 805 35 6 2445 3234 85507172 85507969 0.000000e+00 1151.0
35 TraesCS3B01G146100 chr1B 91.971 822 66 0 977 1798 174252474 174251653 0.000000e+00 1153.0
36 TraesCS3B01G146100 chr1B 91.413 361 31 0 1789 2149 174251875 174251515 2.240000e-136 496.0
37 TraesCS3B01G146100 chr5D 92.298 792 42 5 2454 3234 56055672 56054889 0.000000e+00 1107.0
38 TraesCS3B01G146100 chr2B 93.026 760 50 1 1039 1798 464878512 464879268 0.000000e+00 1107.0
39 TraesCS3B01G146100 chr2B 91.136 361 32 0 1789 2149 464879046 464879406 1.040000e-134 490.0
40 TraesCS3B01G146100 chr2B 90.884 362 31 2 1789 2149 464898636 464898996 4.850000e-133 484.0
41 TraesCS3B01G146100 chr2B 90.476 105 10 0 974 1078 464898004 464898108 4.350000e-29 139.0
42 TraesCS3B01G146100 chr4B 90.447 806 57 8 2445 3234 584135501 584136302 0.000000e+00 1044.0
43 TraesCS3B01G146100 chr7D 90.741 756 55 6 2492 3234 9274603 9275356 0.000000e+00 994.0
44 TraesCS3B01G146100 chr7D 86.411 287 27 5 61 335 47762044 47762330 1.460000e-78 303.0
45 TraesCS3B01G146100 chr7D 90.000 100 10 0 325 424 603882530 603882629 2.620000e-26 130.0
46 TraesCS3B01G146100 chrUn 88.060 737 74 6 2499 3234 41403703 41404426 0.000000e+00 861.0
47 TraesCS3B01G146100 chr1A 90.972 288 22 3 2452 2739 42596281 42595998 5.060000e-103 385.0
48 TraesCS3B01G146100 chr1A 88.889 207 19 3 2246 2449 247806266 247806061 5.360000e-63 252.0
49 TraesCS3B01G146100 chr1A 89.189 74 5 2 2147 2220 247806619 247806549 4.440000e-14 89.8
50 TraesCS3B01G146100 chr5B 94.413 179 7 3 2451 2627 697922583 697922760 4.110000e-69 272.0
51 TraesCS3B01G146100 chr5B 84.190 253 32 6 70 314 166358077 166358329 4.170000e-59 239.0
52 TraesCS3B01G146100 chr6B 93.785 177 7 4 2449 2623 685008054 685008228 2.470000e-66 263.0
53 TraesCS3B01G146100 chr4A 83.224 304 23 1 417 692 252337291 252337594 1.490000e-63 254.0
54 TraesCS3B01G146100 chr4A 91.111 180 15 1 688 867 255587222 255587400 3.220000e-60 243.0
55 TraesCS3B01G146100 chr4A 97.000 100 3 0 325 424 252336790 252336889 5.550000e-38 169.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G146100 chr3B 135710387 135713620 3233 False 5973.000000 5973 100.000000 1 3234 1 chr3B.!!$F1 3233
1 TraesCS3B01G146100 chr3B 135768305 135770257 1952 False 3352.000000 3352 97.699000 503 2449 1 chr3B.!!$F2 1946
2 TraesCS3B01G146100 chr3B 135813886 135815242 1356 False 2331.000000 2331 97.651000 1090 2449 1 chr3B.!!$F4 1359
3 TraesCS3B01G146100 chr3B 135807328 135808420 1092 False 1969.000000 1969 99.177000 1 1094 1 chr3B.!!$F3 1093
4 TraesCS3B01G146100 chr3B 526044178 526044970 792 False 1074.000000 1074 91.321000 2452 3234 1 chr3B.!!$F5 782
5 TraesCS3B01G146100 chr3B 135749560 135750483 923 False 418.000000 669 95.498500 1 515 2 chr3B.!!$F6 514
6 TraesCS3B01G146100 chr3D 85825644 85828451 2807 False 1213.000000 2942 94.187333 61 2449 3 chr3D.!!$F3 2388
7 TraesCS3B01G146100 chr3D 614651288 614652055 767 False 1114.000000 1114 93.041000 2472 3234 1 chr3D.!!$F2 762
8 TraesCS3B01G146100 chr3A 102388350 102389893 1543 False 813.333333 1347 91.908667 733 2446 3 chr3A.!!$F5 1713
9 TraesCS3B01G146100 chr3A 102435382 102437374 1992 False 688.750000 1375 93.697750 611 2449 4 chr3A.!!$F6 1838
10 TraesCS3B01G146100 chr3A 102490151 102492324 2173 False 453.000000 675 93.323667 611 2449 3 chr3A.!!$F7 1838
11 TraesCS3B01G146100 chr2D 393204782 393205604 822 False 1243.000000 1243 93.925000 976 1798 1 chr2D.!!$F2 822
12 TraesCS3B01G146100 chr2D 393069612 393070370 758 False 1125.000000 1125 93.412000 1040 1798 1 chr2D.!!$F1 758
13 TraesCS3B01G146100 chr2D 409582892 409583676 784 False 1088.000000 1088 91.771000 2445 3234 1 chr2D.!!$F3 789
14 TraesCS3B01G146100 chr1D 113994119 113994937 818 True 1188.000000 1188 92.822000 977 1798 1 chr1D.!!$R1 821
15 TraesCS3B01G146100 chr6D 428946692 428947472 780 True 1164.000000 1164 93.528000 2449 3234 1 chr6D.!!$R1 785
16 TraesCS3B01G146100 chr6D 85507172 85507969 797 False 1151.000000 1151 92.919000 2445 3234 1 chr6D.!!$F1 789
17 TraesCS3B01G146100 chr1B 174251515 174252474 959 True 824.500000 1153 91.692000 977 2149 2 chr1B.!!$R1 1172
18 TraesCS3B01G146100 chr5D 56054889 56055672 783 True 1107.000000 1107 92.298000 2454 3234 1 chr5D.!!$R1 780
19 TraesCS3B01G146100 chr2B 464878512 464879406 894 False 798.500000 1107 92.081000 1039 2149 2 chr2B.!!$F1 1110
20 TraesCS3B01G146100 chr2B 464898004 464898996 992 False 311.500000 484 90.680000 974 2149 2 chr2B.!!$F2 1175
21 TraesCS3B01G146100 chr4B 584135501 584136302 801 False 1044.000000 1044 90.447000 2445 3234 1 chr4B.!!$F1 789
22 TraesCS3B01G146100 chr7D 9274603 9275356 753 False 994.000000 994 90.741000 2492 3234 1 chr7D.!!$F1 742
23 TraesCS3B01G146100 chrUn 41403703 41404426 723 False 861.000000 861 88.060000 2499 3234 1 chrUn.!!$F1 735
24 TraesCS3B01G146100 chr4A 252336790 252337594 804 False 211.500000 254 90.112000 325 692 2 chr4A.!!$F2 367

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1924 2737 1.09805 GCGGCTTCTTTGATCACCAT 58.902 50.0 0.0 0.0 0.0 3.55 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2820 4099 1.0042 GGTGACGGGAATGGAACGT 60.004 57.895 0.0 0.0 44.35 3.99 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1924 2737 1.098050 GCGGCTTCTTTGATCACCAT 58.902 50.000 0.00 0.00 0.00 3.55
2400 3656 9.502091 TCATCACCTATTGTGCCTAAATATAAC 57.498 33.333 0.00 0.00 45.03 1.89
2458 3714 1.299976 CTGCTACAACACCCCCTCC 59.700 63.158 0.00 0.00 0.00 4.30
2470 3726 3.708121 ACACCCCCTCCTAAAACGTATAG 59.292 47.826 0.00 0.00 0.00 1.31
2647 3915 2.390599 CCACGTTGGCATCGACAGG 61.391 63.158 23.38 16.74 0.00 4.00
2649 3917 1.667830 ACGTTGGCATCGACAGGTG 60.668 57.895 23.38 0.00 0.00 4.00
2722 3994 2.125310 CCTAACGCATCCACGCCA 60.125 61.111 0.00 0.00 36.19 5.69
2836 4115 1.004320 CCACGTTCCATTCCCGTCA 60.004 57.895 0.00 0.00 31.46 4.35
2972 4262 2.369629 CGCCGTCATCACGTTCGTT 61.370 57.895 0.00 0.00 45.17 3.85
2980 4270 2.117137 CATCACGTTCGTTATCGGAGG 58.883 52.381 0.00 0.00 36.63 4.30
3008 4298 2.125106 GGCTGAAATCCTCGCCGT 60.125 61.111 0.00 0.00 35.18 5.68
3092 4382 4.084276 TGTTACACGGTGTTTGATTGATCG 60.084 41.667 20.15 0.00 0.00 3.69
3095 4385 3.430895 ACACGGTGTTTGATTGATCGTAC 59.569 43.478 8.21 0.00 0.00 3.67
3144 4436 0.036732 GGAGGGCGATTATGATGGCA 59.963 55.000 6.79 0.00 38.59 4.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
293 294 4.236935 CATGCTTGCAACGGTAGATTTTT 58.763 39.130 0.00 0.00 0.00 1.94
1742 2555 1.674322 AGCGTGGGGTTGTGTATGC 60.674 57.895 0.00 0.00 0.00 3.14
1924 2737 0.457853 GGCTGCTGATGTCGACGTAA 60.458 55.000 10.95 1.69 0.00 3.18
2349 3605 4.645863 TGATAACATGCAGCTATCCCAT 57.354 40.909 0.00 0.00 0.00 4.00
2400 3656 2.245159 TCAGAATTATGGCGAGCAGG 57.755 50.000 0.00 0.00 0.00 4.85
2503 3759 2.269883 GGCGTCGGGTGGGTATTT 59.730 61.111 0.00 0.00 0.00 1.40
2639 3907 3.485463 TTTTCTCCAACACCTGTCGAT 57.515 42.857 0.00 0.00 0.00 3.59
2820 4099 1.004200 GGTGACGGGAATGGAACGT 60.004 57.895 0.00 0.00 44.35 3.99
2980 4270 2.294512 GGATTTCAGCCGGATCCATTTC 59.705 50.000 13.41 0.00 39.30 2.17
3008 4298 1.021202 CAAACCAACCTCTTGCACGA 58.979 50.000 0.00 0.00 0.00 4.35
3107 4399 5.889289 GCCCTCCTCCTCTAACTATACATAG 59.111 48.000 0.00 0.00 36.46 2.23
3108 4400 5.573090 CGCCCTCCTCCTCTAACTATACATA 60.573 48.000 0.00 0.00 0.00 2.29
3144 4436 2.277084 GTTGTCCTCGCCGTAATCATT 58.723 47.619 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.