Multiple sequence alignment - TraesCS3B01G145700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G145700 chr3B 100.000 8243 0 0 1 8243 134965818 134974060 0.000000e+00 15223.0
1 TraesCS3B01G145700 chr3B 98.418 8279 93 10 1 8243 135003908 134995632 0.000000e+00 14528.0
2 TraesCS3B01G145700 chr3B 88.613 1449 105 20 2327 3740 131055282 131056705 0.000000e+00 1707.0
3 TraesCS3B01G145700 chr3B 83.862 1134 123 31 1244 2325 131054125 131055250 0.000000e+00 1026.0
4 TraesCS3B01G145700 chr3B 84.070 973 101 30 6518 7451 131062865 131063822 0.000000e+00 889.0
5 TraesCS3B01G145700 chr3B 89.595 692 69 3 4267 4957 131060392 131061081 0.000000e+00 876.0
6 TraesCS3B01G145700 chr3B 85.402 733 67 19 5695 6420 131062006 131062705 0.000000e+00 725.0
7 TraesCS3B01G145700 chr3B 79.275 1076 155 37 2327 3363 135680451 135681497 0.000000e+00 689.0
8 TraesCS3B01G145700 chr3B 77.446 1104 172 46 2327 3395 135709384 135710445 9.220000e-164 588.0
9 TraesCS3B01G145700 chr3B 77.507 1107 166 52 2327 3395 135806325 135807386 9.220000e-164 588.0
10 TraesCS3B01G145700 chr3B 87.411 421 38 8 6518 6928 133812033 133811618 3.480000e-128 470.0
11 TraesCS3B01G145700 chr3B 81.132 477 59 21 6518 6973 133802779 133802313 3.660000e-93 353.0
12 TraesCS3B01G145700 chr3B 88.235 255 5 2 7452 7688 134978256 134978503 1.750000e-71 281.0
13 TraesCS3B01G145700 chr3B 88.235 255 5 2 7452 7688 134991435 134991188 1.750000e-71 281.0
14 TraesCS3B01G145700 chr3B 88.350 206 20 3 3841 4045 131059669 131059871 2.300000e-60 244.0
15 TraesCS3B01G145700 chr3B 86.607 224 27 3 2359 2581 133816551 133816330 2.300000e-60 244.0
16 TraesCS3B01G145700 chr3B 79.661 177 32 4 7157 7333 136079841 136080013 3.120000e-24 124.0
17 TraesCS3B01G145700 chr3B 92.857 84 5 1 4027 4109 131059945 131060028 4.040000e-23 121.0
18 TraesCS3B01G145700 chr3B 81.757 148 18 7 7183 7323 133811148 133811003 1.880000e-21 115.0
19 TraesCS3B01G145700 chr3B 78.947 152 28 4 7182 7333 135687928 135688075 5.260000e-17 100.0
20 TraesCS3B01G145700 chr3B 82.105 95 15 2 1142 1236 133817924 133817832 6.860000e-11 80.5
21 TraesCS3B01G145700 chr3A 93.155 3331 144 37 2323 5590 102275778 102279087 0.000000e+00 4811.0
22 TraesCS3B01G145700 chr3A 94.615 1764 75 8 5694 7452 102279086 102280834 0.000000e+00 2713.0
23 TraesCS3B01G145700 chr3A 90.278 792 46 10 896 1660 102274635 102275422 0.000000e+00 1007.0
24 TraesCS3B01G145700 chr3A 85.852 827 67 24 1 799 102273833 102274637 0.000000e+00 833.0
25 TraesCS3B01G145700 chr3A 76.564 1391 222 62 2327 3649 102360132 102361486 0.000000e+00 667.0
26 TraesCS3B01G145700 chr3A 98.165 327 6 0 1999 2325 102275424 102275750 9.280000e-159 571.0
27 TraesCS3B01G145700 chr3A 87.621 412 33 11 6530 6928 101886870 101886464 5.830000e-126 462.0
28 TraesCS3B01G145700 chr3A 75.216 1158 194 59 2532 3629 102474031 102475155 5.830000e-126 462.0
29 TraesCS3B01G145700 chr3A 78.313 747 131 22 1866 2591 101891643 101890907 3.510000e-123 453.0
30 TraesCS3B01G145700 chr3A 74.978 1159 196 60 2532 3629 102524869 102525994 1.630000e-121 448.0
31 TraesCS3B01G145700 chr3A 76.437 522 102 20 1796 2302 102307894 102307379 6.340000e-66 263.0
32 TraesCS3B01G145700 chr3A 79.863 293 39 11 6637 6914 101866554 101866267 6.530000e-46 196.0
33 TraesCS3B01G145700 chr3A 95.690 116 5 0 5580 5695 664694754 664694639 3.930000e-43 187.0
34 TraesCS3B01G145700 chr3A 96.429 112 4 0 5587 5698 550641947 550641836 1.410000e-42 185.0
35 TraesCS3B01G145700 chr3A 81.000 100 18 1 1142 1240 101892268 101892169 2.470000e-10 78.7
36 TraesCS3B01G145700 chr3D 97.529 1295 27 4 2323 3616 85400054 85401344 0.000000e+00 2209.0
37 TraesCS3B01G145700 chr3D 92.132 1487 80 17 876 2325 85398543 85400029 0.000000e+00 2063.0
38 TraesCS3B01G145700 chr3D 90.858 1411 64 21 3727 5082 85401347 85402747 0.000000e+00 1831.0
39 TraesCS3B01G145700 chr3D 93.464 1071 44 11 5694 6756 85403363 85404415 0.000000e+00 1567.0
40 TraesCS3B01G145700 chr3D 94.747 514 23 2 5081 5590 85402851 85403364 0.000000e+00 797.0
41 TraesCS3B01G145700 chr3D 78.853 1064 156 38 2370 3395 85587851 85588883 0.000000e+00 654.0
42 TraesCS3B01G145700 chr3D 91.443 409 33 2 475 882 85398185 85398592 2.010000e-155 560.0
43 TraesCS3B01G145700 chr3D 78.111 900 127 36 2327 3183 85443720 85444592 2.650000e-139 507.0
44 TraesCS3B01G145700 chr3D 78.610 748 121 27 1874 2588 85238128 85238869 7.540000e-125 459.0
45 TraesCS3B01G145700 chr3D 87.105 411 41 7 6530 6930 84905612 84905204 9.750000e-124 455.0
46 TraesCS3B01G145700 chr3D 83.445 447 45 17 6518 6940 85592210 85592651 1.000000e-103 388.0
47 TraesCS3B01G145700 chr3D 83.834 433 43 13 6518 6927 85888281 85888709 3.610000e-103 387.0
48 TraesCS3B01G145700 chr3D 81.992 472 57 21 6518 6972 84896932 84896472 7.810000e-100 375.0
49 TraesCS3B01G145700 chr3D 78.812 505 77 20 2901 3396 85245997 85246480 6.210000e-81 313.0
50 TraesCS3B01G145700 chr3D 76.967 521 100 18 1796 2302 85411016 85410502 6.300000e-71 279.0
51 TraesCS3B01G145700 chr3D 80.226 177 31 4 7157 7333 85888952 85889124 6.710000e-26 130.0
52 TraesCS3B01G145700 chr3D 88.172 93 7 4 7181 7272 85250952 85251041 3.150000e-19 108.0
53 TraesCS3B01G145700 chr3D 78.947 152 28 4 7182 7333 85449993 85450140 5.260000e-17 100.0
54 TraesCS3B01G145700 chr7A 90.506 811 48 9 7452 8243 171869157 171869957 0.000000e+00 1044.0
55 TraesCS3B01G145700 chr7A 90.012 811 52 9 7452 8243 171754873 171755673 0.000000e+00 1022.0
56 TraesCS3B01G145700 chr7A 89.864 809 57 5 7452 8243 148824472 148823672 0.000000e+00 1016.0
57 TraesCS3B01G145700 chr7A 93.902 164 3 3 7452 7615 171873392 171873548 2.970000e-59 241.0
58 TraesCS3B01G145700 chrUn 90.259 811 50 9 7452 8243 405157339 405158139 0.000000e+00 1033.0
59 TraesCS3B01G145700 chrUn 90.136 811 51 9 7452 8243 247469353 247468553 0.000000e+00 1027.0
60 TraesCS3B01G145700 chr6B 89.988 809 56 10 7452 8243 462688681 462689481 0.000000e+00 1022.0
61 TraesCS3B01G145700 chr7D 89.987 789 50 9 7451 8221 631310673 631309896 0.000000e+00 992.0
62 TraesCS3B01G145700 chr1A 88.999 809 61 11 7452 8242 547435364 547436162 0.000000e+00 976.0
63 TraesCS3B01G145700 chr5A 80.936 299 33 16 6046 6335 658996271 658996554 1.800000e-51 215.0
64 TraesCS3B01G145700 chr5A 95.614 114 5 0 5589 5702 7007435 7007322 5.080000e-42 183.0
65 TraesCS3B01G145700 chr5A 92.126 127 9 1 5583 5709 140818061 140817936 2.360000e-40 178.0
66 TraesCS3B01G145700 chr4A 95.000 120 4 2 5589 5708 132996367 132996250 3.930000e-43 187.0
67 TraesCS3B01G145700 chr2A 94.215 121 5 2 5581 5701 187955928 187955810 5.080000e-42 183.0
68 TraesCS3B01G145700 chr2A 94.872 117 6 0 5586 5702 391874309 391874425 5.080000e-42 183.0
69 TraesCS3B01G145700 chr2A 94.118 119 7 0 5589 5707 96153218 96153100 1.830000e-41 182.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G145700 chr3B 134965818 134974060 8242 False 15223.000000 15223 100.000000 1 8243 1 chr3B.!!$F1 8242
1 TraesCS3B01G145700 chr3B 134995632 135003908 8276 True 14528.000000 14528 98.418000 1 8243 1 chr3B.!!$R3 8242
2 TraesCS3B01G145700 chr3B 131054125 131063822 9697 False 798.285714 1707 87.535571 1244 7451 7 chr3B.!!$F8 6207
3 TraesCS3B01G145700 chr3B 135680451 135681497 1046 False 689.000000 689 79.275000 2327 3363 1 chr3B.!!$F3 1036
4 TraesCS3B01G145700 chr3B 135709384 135710445 1061 False 588.000000 588 77.446000 2327 3395 1 chr3B.!!$F5 1068
5 TraesCS3B01G145700 chr3B 135806325 135807386 1061 False 588.000000 588 77.507000 2327 3395 1 chr3B.!!$F6 1068
6 TraesCS3B01G145700 chr3B 133811003 133812033 1030 True 292.500000 470 84.584000 6518 7323 2 chr3B.!!$R4 805
7 TraesCS3B01G145700 chr3A 102273833 102280834 7001 False 1987.000000 4811 92.413000 1 7452 5 chr3A.!!$F4 7451
8 TraesCS3B01G145700 chr3A 102360132 102361486 1354 False 667.000000 667 76.564000 2327 3649 1 chr3A.!!$F1 1322
9 TraesCS3B01G145700 chr3A 102474031 102475155 1124 False 462.000000 462 75.216000 2532 3629 1 chr3A.!!$F2 1097
10 TraesCS3B01G145700 chr3A 102524869 102525994 1125 False 448.000000 448 74.978000 2532 3629 1 chr3A.!!$F3 1097
11 TraesCS3B01G145700 chr3A 101890907 101892268 1361 True 265.850000 453 79.656500 1142 2591 2 chr3A.!!$R6 1449
12 TraesCS3B01G145700 chr3A 102307379 102307894 515 True 263.000000 263 76.437000 1796 2302 1 chr3A.!!$R3 506
13 TraesCS3B01G145700 chr3D 85398185 85404415 6230 False 1504.500000 2209 93.362167 475 6756 6 chr3D.!!$F6 6281
14 TraesCS3B01G145700 chr3D 85587851 85592651 4800 False 521.000000 654 81.149000 2370 6940 2 chr3D.!!$F7 4570
15 TraesCS3B01G145700 chr3D 85443720 85444592 872 False 507.000000 507 78.111000 2327 3183 1 chr3D.!!$F4 856
16 TraesCS3B01G145700 chr3D 85238128 85238869 741 False 459.000000 459 78.610000 1874 2588 1 chr3D.!!$F1 714
17 TraesCS3B01G145700 chr3D 85410502 85411016 514 True 279.000000 279 76.967000 1796 2302 1 chr3D.!!$R3 506
18 TraesCS3B01G145700 chr3D 85888281 85889124 843 False 258.500000 387 82.030000 6518 7333 2 chr3D.!!$F8 815
19 TraesCS3B01G145700 chr7A 171754873 171755673 800 False 1022.000000 1022 90.012000 7452 8243 1 chr7A.!!$F1 791
20 TraesCS3B01G145700 chr7A 148823672 148824472 800 True 1016.000000 1016 89.864000 7452 8243 1 chr7A.!!$R1 791
21 TraesCS3B01G145700 chr7A 171869157 171873548 4391 False 642.500000 1044 92.204000 7452 8243 2 chr7A.!!$F2 791
22 TraesCS3B01G145700 chrUn 405157339 405158139 800 False 1033.000000 1033 90.259000 7452 8243 1 chrUn.!!$F1 791
23 TraesCS3B01G145700 chrUn 247468553 247469353 800 True 1027.000000 1027 90.136000 7452 8243 1 chrUn.!!$R1 791
24 TraesCS3B01G145700 chr6B 462688681 462689481 800 False 1022.000000 1022 89.988000 7452 8243 1 chr6B.!!$F1 791
25 TraesCS3B01G145700 chr7D 631309896 631310673 777 True 992.000000 992 89.987000 7451 8221 1 chr7D.!!$R1 770
26 TraesCS3B01G145700 chr1A 547435364 547436162 798 False 976.000000 976 88.999000 7452 8242 1 chr1A.!!$F1 790

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
692 728 0.396435 TTGTCATTGCGAGTGGGTCT 59.604 50.000 0.0 0.0 0.00 3.85 F
1118 1172 0.682532 TCTCTGCCTCGCTCTGTGAT 60.683 55.000 0.0 0.0 0.00 3.06 F
1167 1221 1.081892 GCGTGTGTGCAGATGAGAAT 58.918 50.000 0.0 0.0 34.15 2.40 F
2199 2388 0.248565 TCAGCTCAGTCTGGTGATGC 59.751 55.000 0.0 0.0 37.07 3.91 F
2488 2710 1.963515 GACCACCACTTTTCATGGCTT 59.036 47.619 0.0 0.0 41.31 4.35 F
3574 3886 2.100989 GAACTCTCGTGGTAGGGTGAT 58.899 52.381 0.0 0.0 28.06 3.06 F
5039 8825 3.255888 GTCATGGATCTCATAGCGTGGTA 59.744 47.826 0.0 0.0 34.12 3.25 F
5075 8861 0.459899 TCATGTACCGGCTGTGCTAG 59.540 55.000 0.0 0.0 0.00 3.42 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1699 1842 4.375272 ACTCTTGTCGGCATATCAATCTG 58.625 43.478 0.00 0.00 0.00 2.90 R
2199 2388 4.559862 AGGAAATACTTGACAGTGGGAG 57.440 45.455 0.00 0.00 34.06 4.30 R
2478 2700 4.766373 TGCTCATTTGTAGAAGCCATGAAA 59.234 37.500 0.00 0.00 0.00 2.69 R
3574 3886 1.956869 ATGGTGGATGTGGAGTGAGA 58.043 50.000 0.00 0.00 0.00 3.27 R
3968 7260 2.999185 ACATTGTGGGAAGGAACCAT 57.001 45.000 0.00 0.00 40.70 3.55 R
5039 8825 0.973632 TGATGCCGGTGTACTTCACT 59.026 50.000 1.90 0.00 45.50 3.41 R
6443 10853 9.472361 AATTTACATGTACCTACGTATGATCAC 57.528 33.333 4.68 1.07 0.00 3.06 R
7326 12436 2.859870 TTTCCGCGTGAATTTCGTAC 57.140 45.000 4.92 0.00 31.67 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.