Multiple sequence alignment - TraesCS3B01G140600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G140600 chr3B 100.000 3560 0 0 1 3560 126734634 126731075 0.000000e+00 6575.0
1 TraesCS3B01G140600 chr3B 99.006 1207 11 1 1 1207 126756371 126755166 0.000000e+00 2161.0
2 TraesCS3B01G140600 chr3B 87.487 1878 151 31 853 2694 126664775 126662946 0.000000e+00 2089.0
3 TraesCS3B01G140600 chr3B 99.883 854 0 1 2001 2854 126714405 126713553 0.000000e+00 1570.0
4 TraesCS3B01G140600 chr3B 83.982 1567 192 28 889 2418 126400941 126399397 0.000000e+00 1448.0
5 TraesCS3B01G140600 chr3B 98.034 712 12 1 2849 3560 806997710 806997001 0.000000e+00 1236.0
6 TraesCS3B01G140600 chr3B 100.000 542 0 0 893 1434 126715202 126714661 0.000000e+00 1002.0
7 TraesCS3B01G140600 chr3B 77.461 386 68 17 2849 3223 736143937 736143560 2.780000e-51 213.0
8 TraesCS3B01G140600 chr3D 92.101 2228 101 33 473 2672 81122741 81120561 0.000000e+00 3070.0
9 TraesCS3B01G140600 chr3D 83.646 1437 181 23 1026 2426 80630486 80629068 0.000000e+00 1303.0
10 TraesCS3B01G140600 chr3D 87.825 1117 80 25 1587 2683 81057143 81056063 0.000000e+00 1258.0
11 TraesCS3B01G140600 chr3D 87.645 947 107 7 1477 2418 80917031 80916090 0.000000e+00 1092.0
12 TraesCS3B01G140600 chr3D 85.903 986 129 8 1477 2457 80600902 80599922 0.000000e+00 1042.0
13 TraesCS3B01G140600 chr3D 89.589 730 46 11 853 1569 81057913 81057201 0.000000e+00 900.0
14 TraesCS3B01G140600 chr3D 88.488 443 35 8 1 438 81123456 81123025 4.070000e-144 521.0
15 TraesCS3B01G140600 chr3D 82.215 596 85 13 889 1481 80917640 80917063 8.880000e-136 494.0
16 TraesCS3B01G140600 chr3D 80.769 598 74 19 888 1481 80601500 80600940 2.540000e-116 429.0
17 TraesCS3B01G140600 chr3D 94.286 35 2 0 1396 1430 396434517 396434551 2.000000e-03 54.7
18 TraesCS3B01G140600 chr3A 91.681 2248 97 25 472 2684 95360236 95358044 0.000000e+00 3033.0
19 TraesCS3B01G140600 chr3A 88.883 1817 121 31 872 2648 95127541 95125766 0.000000e+00 2161.0
20 TraesCS3B01G140600 chr3A 91.338 1570 97 15 937 2483 95134589 95133036 0.000000e+00 2109.0
21 TraesCS3B01G140600 chr3A 83.483 1562 201 30 888 2418 94859287 94857752 0.000000e+00 1402.0
22 TraesCS3B01G140600 chr3A 87.487 983 115 6 1477 2455 94254833 94253855 0.000000e+00 1127.0
23 TraesCS3B01G140600 chr3A 81.793 357 37 8 478 829 95135607 95135274 1.260000e-69 274.0
24 TraesCS3B01G140600 chr3A 91.613 155 11 2 2568 2721 95131648 95131495 2.780000e-51 213.0
25 TraesCS3B01G140600 chr6D 96.067 712 24 3 2849 3560 39587855 39587148 0.000000e+00 1157.0
26 TraesCS3B01G140600 chr6D 83.333 108 15 3 3436 3542 471978334 471978229 2.930000e-16 97.1
27 TraesCS3B01G140600 chr6D 83.333 108 15 3 3436 3542 472045671 472045566 2.930000e-16 97.1
28 TraesCS3B01G140600 chr7B 96.700 697 12 4 2857 3545 4584556 4585249 0.000000e+00 1149.0
29 TraesCS3B01G140600 chr7D 80.242 1407 218 25 1033 2424 50428923 50427562 0.000000e+00 1003.0
30 TraesCS3B01G140600 chr7D 79.689 1413 214 32 1051 2446 50641735 50640379 0.000000e+00 952.0
31 TraesCS3B01G140600 chr4A 79.959 1452 218 38 1016 2443 665318883 665317481 0.000000e+00 1002.0
32 TraesCS3B01G140600 chr7A 90.642 716 56 7 2849 3556 492230572 492229860 0.000000e+00 941.0
33 TraesCS3B01G140600 chr7A 75.831 451 80 20 2838 3269 17939689 17939249 6.030000e-48 202.0
34 TraesCS3B01G140600 chr7A 83.333 150 17 3 3170 3311 692369044 692369193 8.020000e-27 132.0
35 TraesCS3B01G140600 chr7A 82.781 151 17 4 3170 3311 692392890 692393040 3.730000e-25 126.0
36 TraesCS3B01G140600 chr4B 76.211 454 80 19 2834 3269 105625085 105625528 7.740000e-52 215.0
37 TraesCS3B01G140600 chr4B 75.737 441 74 21 2850 3269 530494585 530494157 1.300000e-44 191.0
38 TraesCS3B01G140600 chrUn 90.741 162 12 3 3017 3175 83928048 83927887 2.780000e-51 213.0
39 TraesCS3B01G140600 chrUn 81.068 206 33 4 2849 3049 243658009 243658213 3.680000e-35 159.0
40 TraesCS3B01G140600 chrUn 81.068 206 33 4 2849 3049 245881694 245881898 3.680000e-35 159.0
41 TraesCS3B01G140600 chr6A 85.057 174 21 5 3373 3544 23474199 23474369 4.730000e-39 172.0
42 TraesCS3B01G140600 chr5A 81.731 208 27 6 2849 3049 112121736 112121939 2.840000e-36 163.0
43 TraesCS3B01G140600 chr2B 81.463 205 33 3 2849 3049 191730546 191730749 2.840000e-36 163.0
44 TraesCS3B01G140600 chr2B 84.615 104 5 3 2761 2854 18003992 18004094 3.780000e-15 93.5
45 TraesCS3B01G140600 chr2B 87.500 80 8 2 2776 2854 46876790 46876868 1.360000e-14 91.6
46 TraesCS3B01G140600 chr2B 97.619 42 1 0 2804 2845 519338592 519338551 4.930000e-09 73.1
47 TraesCS3B01G140600 chr1B 81.463 205 33 3 2849 3049 14742081 14742284 2.840000e-36 163.0
48 TraesCS3B01G140600 chr2D 97.143 35 1 0 2761 2795 609466878 609466912 3.840000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G140600 chr3B 126731075 126734634 3559 True 6575.00 6575 100.00000 1 3560 1 chr3B.!!$R3 3559
1 TraesCS3B01G140600 chr3B 126755166 126756371 1205 True 2161.00 2161 99.00600 1 1207 1 chr3B.!!$R4 1206
2 TraesCS3B01G140600 chr3B 126662946 126664775 1829 True 2089.00 2089 87.48700 853 2694 1 chr3B.!!$R2 1841
3 TraesCS3B01G140600 chr3B 126399397 126400941 1544 True 1448.00 1448 83.98200 889 2418 1 chr3B.!!$R1 1529
4 TraesCS3B01G140600 chr3B 126713553 126715202 1649 True 1286.00 1570 99.94150 893 2854 2 chr3B.!!$R7 1961
5 TraesCS3B01G140600 chr3B 806997001 806997710 709 True 1236.00 1236 98.03400 2849 3560 1 chr3B.!!$R6 711
6 TraesCS3B01G140600 chr3D 81120561 81123456 2895 True 1795.50 3070 90.29450 1 2672 2 chr3D.!!$R5 2671
7 TraesCS3B01G140600 chr3D 80629068 80630486 1418 True 1303.00 1303 83.64600 1026 2426 1 chr3D.!!$R1 1400
8 TraesCS3B01G140600 chr3D 81056063 81057913 1850 True 1079.00 1258 88.70700 853 2683 2 chr3D.!!$R4 1830
9 TraesCS3B01G140600 chr3D 80916090 80917640 1550 True 793.00 1092 84.93000 889 2418 2 chr3D.!!$R3 1529
10 TraesCS3B01G140600 chr3D 80599922 80601500 1578 True 735.50 1042 83.33600 888 2457 2 chr3D.!!$R2 1569
11 TraesCS3B01G140600 chr3A 95358044 95360236 2192 True 3033.00 3033 91.68100 472 2684 1 chr3A.!!$R3 2212
12 TraesCS3B01G140600 chr3A 94857752 94859287 1535 True 1402.00 1402 83.48300 888 2418 1 chr3A.!!$R2 1530
13 TraesCS3B01G140600 chr3A 95125766 95135607 9841 True 1189.25 2161 88.40675 478 2721 4 chr3A.!!$R4 2243
14 TraesCS3B01G140600 chr3A 94253855 94254833 978 True 1127.00 1127 87.48700 1477 2455 1 chr3A.!!$R1 978
15 TraesCS3B01G140600 chr6D 39587148 39587855 707 True 1157.00 1157 96.06700 2849 3560 1 chr6D.!!$R1 711
16 TraesCS3B01G140600 chr7B 4584556 4585249 693 False 1149.00 1149 96.70000 2857 3545 1 chr7B.!!$F1 688
17 TraesCS3B01G140600 chr7D 50427562 50428923 1361 True 1003.00 1003 80.24200 1033 2424 1 chr7D.!!$R1 1391
18 TraesCS3B01G140600 chr7D 50640379 50641735 1356 True 952.00 952 79.68900 1051 2446 1 chr7D.!!$R2 1395
19 TraesCS3B01G140600 chr4A 665317481 665318883 1402 True 1002.00 1002 79.95900 1016 2443 1 chr4A.!!$R1 1427
20 TraesCS3B01G140600 chr7A 492229860 492230572 712 True 941.00 941 90.64200 2849 3556 1 chr7A.!!$R2 707

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
443 447 3.795623 TGAAGACCACTCTTATACCGC 57.204 47.619 0.0 0.0 36.82 5.68 F
685 946 4.873259 GGAGACAATCCTTCTTCTACAAGC 59.127 45.833 0.0 0.0 45.64 4.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1996 10135 3.479269 CGCCGCGAAGGTCTTGTC 61.479 66.667 8.23 0.0 43.7 3.18 R
3410 11606 2.014033 GAGAGGAGGGGGAGGTCGAT 62.014 65.000 0.00 0.0 0.0 3.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
204 205 6.767080 TCGAATTTCATGTAACATGTAACCG 58.233 36.000 0.00 0.51 0.00 4.44
443 447 3.795623 TGAAGACCACTCTTATACCGC 57.204 47.619 0.00 0.00 36.82 5.68
685 946 4.873259 GGAGACAATCCTTCTTCTACAAGC 59.127 45.833 0.00 0.00 45.64 4.01
781 1059 4.975502 CAGTTTCATACGCAAAAAGAGCAA 59.024 37.500 0.00 0.00 0.00 3.91
1996 10135 4.078516 GGTCCGTCAAGGTCGGGG 62.079 72.222 4.58 0.00 46.82 5.73
2460 10621 0.966920 CCTCCGGTTCTGTGTAGTGT 59.033 55.000 0.00 0.00 0.00 3.55
2859 11047 9.113838 CTTGTATCAATCTGCCTAGTAAAATGT 57.886 33.333 0.00 0.00 0.00 2.71
3410 11606 3.549433 TACCCTTCCCTCCACGGCA 62.549 63.158 0.00 0.00 0.00 5.69
3534 11738 6.128486 TCACTGCCATGATATACAAAATGGT 58.872 36.000 0.00 0.00 41.42 3.55
3535 11739 7.286313 TCACTGCCATGATATACAAAATGGTA 58.714 34.615 0.00 0.00 41.42 3.25
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
204 205 2.861006 GCCAAGTTCGTCTTCGCC 59.139 61.111 2.74 0.0 34.92 5.54
1996 10135 3.479269 CGCCGCGAAGGTCTTGTC 61.479 66.667 8.23 0.0 43.70 3.18
3410 11606 2.014033 GAGAGGAGGGGGAGGTCGAT 62.014 65.000 0.00 0.0 0.00 3.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.