Multiple sequence alignment - TraesCS3B01G126100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G126100 chr3B 100.000 2195 0 0 1 2195 101919894 101917700 0.000000e+00 4054
1 TraesCS3B01G126100 chr3B 100.000 311 0 0 1387 1697 201528048 201527738 1.890000e-160 575
2 TraesCS3B01G126100 chr3B 99.678 311 1 0 1387 1697 101912199 101911889 8.790000e-159 569
3 TraesCS3B01G126100 chr1A 99.410 1356 8 0 1 1356 554455356 554456711 0.000000e+00 2460
4 TraesCS3B01G126100 chr5D 98.409 1383 20 2 1 1383 503286452 503287832 0.000000e+00 2431
5 TraesCS3B01G126100 chr5D 98.194 1384 19 6 1 1383 6181792 6180414 0.000000e+00 2412
6 TraesCS3B01G126100 chr5D 97.977 1384 23 5 1 1383 120799022 120800401 0.000000e+00 2396
7 TraesCS3B01G126100 chr5D 99.593 492 2 0 1704 2195 503225230 503224739 0.000000e+00 898
8 TraesCS3B01G126100 chr5D 99.390 492 3 0 1704 2195 503235546 503235055 0.000000e+00 893
9 TraesCS3B01G126100 chr5D 99.390 492 3 0 1704 2195 503239796 503239305 0.000000e+00 893
10 TraesCS3B01G126100 chr5D 99.678 311 1 0 1387 1697 446174808 446174498 8.790000e-159 569
11 TraesCS3B01G126100 chr1D 98.265 1383 23 1 1 1383 254416216 254417597 0.000000e+00 2420
12 TraesCS3B01G126100 chr1D 97.616 1384 29 3 1 1383 51878920 51877540 0.000000e+00 2370
13 TraesCS3B01G126100 chr1D 94.583 240 10 2 1145 1383 340454182 340453945 3.440000e-98 368
14 TraesCS3B01G126100 chr1D 95.973 149 5 1 1119 1266 68408997 68409145 7.830000e-60 241
15 TraesCS3B01G126100 chr1D 92.258 155 8 2 1131 1285 454871421 454871271 1.320000e-52 217
16 TraesCS3B01G126100 chr2A 98.120 1383 23 3 1 1383 335831476 335830097 0.000000e+00 2407
17 TraesCS3B01G126100 chr6D 97.905 1384 20 7 1 1383 45512412 45511037 0.000000e+00 2386
18 TraesCS3B01G126100 chr6D 99.390 492 3 0 1704 2195 389251689 389251198 0.000000e+00 893
19 TraesCS3B01G126100 chr6D 99.390 492 3 0 1704 2195 458922326 458921835 0.000000e+00 893
20 TraesCS3B01G126100 chr5A 97.180 1383 38 1 1 1383 607200939 607199558 0.000000e+00 2337
21 TraesCS3B01G126100 chrUn 99.390 492 3 0 1704 2195 352978683 352978192 0.000000e+00 893
22 TraesCS3B01G126100 chrUn 99.357 311 2 0 1387 1697 93408608 93408918 4.090000e-157 564
23 TraesCS3B01G126100 chr3D 99.390 492 3 0 1704 2195 24164103 24164594 0.000000e+00 893
24 TraesCS3B01G126100 chr3D 99.390 492 3 0 1704 2195 598873428 598872937 0.000000e+00 893
25 TraesCS3B01G126100 chr3A 99.390 492 3 0 1704 2195 495098724 495098233 0.000000e+00 893
26 TraesCS3B01G126100 chr7D 99.678 311 1 0 1387 1697 77234840 77235150 8.790000e-159 569
27 TraesCS3B01G126100 chr4A 99.678 311 1 0 1387 1697 73809952 73809642 8.790000e-159 569
28 TraesCS3B01G126100 chr4A 99.678 311 1 0 1387 1697 73810463 73810153 8.790000e-159 569
29 TraesCS3B01G126100 chr4A 99.678 311 1 0 1387 1697 73810984 73810674 8.790000e-159 569
30 TraesCS3B01G126100 chr4A 99.678 311 1 0 1387 1697 73811495 73811185 8.790000e-159 569


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G126100 chr3B 101917700 101919894 2194 True 4054 4054 100.000 1 2195 1 chr3B.!!$R2 2194
1 TraesCS3B01G126100 chr1A 554455356 554456711 1355 False 2460 2460 99.410 1 1356 1 chr1A.!!$F1 1355
2 TraesCS3B01G126100 chr5D 503286452 503287832 1380 False 2431 2431 98.409 1 1383 1 chr5D.!!$F2 1382
3 TraesCS3B01G126100 chr5D 6180414 6181792 1378 True 2412 2412 98.194 1 1383 1 chr5D.!!$R1 1382
4 TraesCS3B01G126100 chr5D 120799022 120800401 1379 False 2396 2396 97.977 1 1383 1 chr5D.!!$F1 1382
5 TraesCS3B01G126100 chr5D 503235055 503239796 4741 True 893 893 99.390 1704 2195 2 chr5D.!!$R4 491
6 TraesCS3B01G126100 chr1D 254416216 254417597 1381 False 2420 2420 98.265 1 1383 1 chr1D.!!$F2 1382
7 TraesCS3B01G126100 chr1D 51877540 51878920 1380 True 2370 2370 97.616 1 1383 1 chr1D.!!$R1 1382
8 TraesCS3B01G126100 chr2A 335830097 335831476 1379 True 2407 2407 98.120 1 1383 1 chr2A.!!$R1 1382
9 TraesCS3B01G126100 chr6D 45511037 45512412 1375 True 2386 2386 97.905 1 1383 1 chr6D.!!$R1 1382
10 TraesCS3B01G126100 chr5A 607199558 607200939 1381 True 2337 2337 97.180 1 1383 1 chr5A.!!$R1 1382
11 TraesCS3B01G126100 chr4A 73809642 73811495 1853 True 569 569 99.678 1387 1697 4 chr4A.!!$R1 310

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
377 381 6.292923 TCAACTCGAATACCAAAAGGAAGAA 58.707 36.0 0.0 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1907 7199 2.760374 CCATTCTATGAGTCGCTTCCC 58.24 52.381 0.0 0.0 0.0 3.97 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
377 381 6.292923 TCAACTCGAATACCAAAAGGAAGAA 58.707 36.000 0.00 0.00 0.00 2.52
700 706 6.474427 TGCGACACTAATAAACACTAGTATGC 59.526 38.462 0.00 0.00 0.00 3.14
1138 1146 9.330063 CAATCGTGGATATTATGCCTGTTATAT 57.670 33.333 0.00 0.00 0.00 0.86
1383 1393 1.861982 TTCTACTCCCCTGCACCTAC 58.138 55.000 0.00 0.00 0.00 3.18
1384 1394 1.008403 TCTACTCCCCTGCACCTACT 58.992 55.000 0.00 0.00 0.00 2.57
1385 1395 1.063867 TCTACTCCCCTGCACCTACTC 60.064 57.143 0.00 0.00 0.00 2.59
1697 2739 4.116782 TCTGGGCCATACAATGCATTAT 57.883 40.909 12.53 2.82 0.00 1.28
1698 2740 4.482030 TCTGGGCCATACAATGCATTATT 58.518 39.130 12.53 4.77 0.00 1.40
1699 2741 4.900652 TCTGGGCCATACAATGCATTATTT 59.099 37.500 12.53 2.10 0.00 1.40
1700 2742 5.366186 TCTGGGCCATACAATGCATTATTTT 59.634 36.000 12.53 0.00 0.00 1.82
1701 2743 5.366460 TGGGCCATACAATGCATTATTTTG 58.634 37.500 12.53 3.26 0.00 2.44
1702 2744 5.104610 TGGGCCATACAATGCATTATTTTGT 60.105 36.000 12.53 9.73 37.37 2.83
1920 7212 1.168714 GCAAAAGGGAAGCGACTCAT 58.831 50.000 0.00 0.00 0.00 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1700 2742 9.444600 GTCTTGTTTTTACTCCTATATTGGACA 57.555 33.333 1.33 0.00 31.94 4.02
1701 2743 8.601476 CGTCTTGTTTTTACTCCTATATTGGAC 58.399 37.037 1.33 0.00 31.94 4.02
1702 2744 8.316214 ACGTCTTGTTTTTACTCCTATATTGGA 58.684 33.333 5.74 5.74 34.52 3.53
1907 7199 2.760374 CCATTCTATGAGTCGCTTCCC 58.240 52.381 0.00 0.00 0.00 3.97
1920 7212 4.744867 GCTCTATTTGCCTCTGCCATTCTA 60.745 45.833 0.00 0.00 36.33 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.