Multiple sequence alignment - TraesCS3B01G124700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G124700 chr3B 100.000 2567 0 0 1 2567 99041992 99044558 0.000000e+00 4741
1 TraesCS3B01G124700 chr3B 99.610 2567 9 1 1 2567 99062976 99065541 0.000000e+00 4684
2 TraesCS3B01G124700 chr3B 90.251 1436 78 24 456 1860 99024178 99025582 0.000000e+00 1820
3 TraesCS3B01G124700 chr3B 88.170 634 56 13 463 1083 99092285 99092912 0.000000e+00 737
4 TraesCS3B01G124700 chr3B 86.228 668 68 11 1166 1825 99092913 99093564 0.000000e+00 702
5 TraesCS3B01G124700 chr3B 93.264 386 22 4 2108 2489 99026157 99026542 1.330000e-157 566
6 TraesCS3B01G124700 chr3B 88.791 455 34 8 1 453 99023500 99023939 2.250000e-150 542
7 TraesCS3B01G124700 chr3B 87.927 439 32 8 1859 2290 99025549 99025973 4.930000e-137 497
8 TraesCS3B01G124700 chr3B 93.989 183 11 0 2108 2290 99025974 99026156 7.000000e-71 278
9 TraesCS3B01G124700 chr3B 89.286 84 9 0 463 546 99092195 99092278 3.490000e-19 106
10 TraesCS3B01G124700 chr3A 93.431 1431 65 15 455 1860 70481077 70482503 0.000000e+00 2095
11 TraesCS3B01G124700 chr3A 87.402 1397 122 28 465 1828 70699685 70701060 0.000000e+00 1555
12 TraesCS3B01G124700 chr3A 94.541 458 23 2 1 457 70480422 70480878 0.000000e+00 706
13 TraesCS3B01G124700 chr3A 93.566 373 23 1 2195 2567 70489837 70490208 2.890000e-154 555
14 TraesCS3B01G124700 chr3A 84.682 346 29 7 1859 2197 70482470 70482798 8.860000e-85 324
15 TraesCS3B01G124700 chr3D 93.186 1042 56 11 986 2026 61605018 61606045 0.000000e+00 1517
16 TraesCS3B01G124700 chr3D 86.848 1399 121 35 463 1823 61675892 61677265 0.000000e+00 1506
17 TraesCS3B01G124700 chr3D 95.197 458 20 2 1 457 61603855 61604311 0.000000e+00 723
18 TraesCS3B01G124700 chr3D 90.820 512 23 12 455 943 61604511 61605021 0.000000e+00 664
19 TraesCS3B01G124700 chr1B 81.111 990 150 29 630 1591 322938718 322937738 0.000000e+00 758
20 TraesCS3B01G124700 chr1A 79.944 1072 158 46 623 1662 290410100 290411146 0.000000e+00 736
21 TraesCS3B01G124700 chr1D 80.622 996 146 34 630 1591 223521053 223520071 0.000000e+00 726


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G124700 chr3B 99041992 99044558 2566 False 4741.000000 4741 100.000000 1 2567 1 chr3B.!!$F1 2566
1 TraesCS3B01G124700 chr3B 99062976 99065541 2565 False 4684.000000 4684 99.610000 1 2567 1 chr3B.!!$F2 2566
2 TraesCS3B01G124700 chr3B 99023500 99026542 3042 False 740.600000 1820 90.844400 1 2489 5 chr3B.!!$F3 2488
3 TraesCS3B01G124700 chr3B 99092195 99093564 1369 False 515.000000 737 87.894667 463 1825 3 chr3B.!!$F4 1362
4 TraesCS3B01G124700 chr3A 70699685 70701060 1375 False 1555.000000 1555 87.402000 465 1828 1 chr3A.!!$F2 1363
5 TraesCS3B01G124700 chr3A 70480422 70482798 2376 False 1041.666667 2095 90.884667 1 2197 3 chr3A.!!$F3 2196
6 TraesCS3B01G124700 chr3D 61675892 61677265 1373 False 1506.000000 1506 86.848000 463 1823 1 chr3D.!!$F1 1360
7 TraesCS3B01G124700 chr3D 61603855 61606045 2190 False 968.000000 1517 93.067667 1 2026 3 chr3D.!!$F2 2025
8 TraesCS3B01G124700 chr1B 322937738 322938718 980 True 758.000000 758 81.111000 630 1591 1 chr1B.!!$R1 961
9 TraesCS3B01G124700 chr1A 290410100 290411146 1046 False 736.000000 736 79.944000 623 1662 1 chr1A.!!$F1 1039
10 TraesCS3B01G124700 chr1D 223520071 223521053 982 True 726.000000 726 80.622000 630 1591 1 chr1D.!!$R1 961

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
114 115 0.681243 GGACAGTGCCAAGATTCCCC 60.681 60.0 0.0 0.0 0.0 4.81 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2053 2476 4.332543 TCAACGACATTCAATATGTGGCTC 59.667 41.667 0.0 0.0 32.1 4.7 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
114 115 0.681243 GGACAGTGCCAAGATTCCCC 60.681 60.000 0.0 0.0 0.00 4.81
870 1235 2.774234 TCCCTCAATCCTTTGCCTCTAG 59.226 50.000 0.0 0.0 32.61 2.43
1554 1946 4.617593 AGTCCCCGTTCCTTTATCTTAGA 58.382 43.478 0.0 0.0 0.00 2.10
2053 2476 1.480137 CACTAGTCTCAGGCTCTTGGG 59.520 57.143 0.0 0.0 0.00 4.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
114 115 2.438392 GGGTGAGAATACAACCCCTAGG 59.562 54.545 0.06 0.06 41.35 3.02
870 1235 6.616947 ACATACTGCGCTATATTCTCTCTTC 58.383 40.000 9.73 0.00 0.00 2.87
1554 1946 8.245491 CACTCGAGATCAGATTATTCATCATCT 58.755 37.037 21.68 0.00 33.75 2.90
2053 2476 4.332543 TCAACGACATTCAATATGTGGCTC 59.667 41.667 0.00 0.00 32.10 4.70


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.