Multiple sequence alignment - TraesCS3B01G122200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G122200 chr3B 100.000 2300 0 0 1 2300 92319009 92321308 0 4248
1 TraesCS3B01G122200 chrUn 98.914 2302 23 2 1 2300 86508840 86506539 0 4111
2 TraesCS3B01G122200 chr6A 98.783 2300 24 1 1 2300 608882064 608879769 0 4089
3 TraesCS3B01G122200 chr6A 98.221 2305 34 3 1 2300 84435316 84437618 0 4023
4 TraesCS3B01G122200 chr6B 98.697 2303 27 3 1 2300 596621495 596623797 0 4084
5 TraesCS3B01G122200 chr2B 98.479 2301 31 4 1 2300 30669441 30667144 0 4052
6 TraesCS3B01G122200 chr4D 98.392 2301 31 2 1 2300 123424886 123427181 0 4039
7 TraesCS3B01G122200 chr6D 98.217 2300 39 2 1 2300 168767960 168770257 0 4019
8 TraesCS3B01G122200 chr5B 98.088 2301 37 3 1 2300 567269423 567267129 0 3999


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G122200 chr3B 92319009 92321308 2299 False 4248 4248 100.000 1 2300 1 chr3B.!!$F1 2299
1 TraesCS3B01G122200 chrUn 86506539 86508840 2301 True 4111 4111 98.914 1 2300 1 chrUn.!!$R1 2299
2 TraesCS3B01G122200 chr6A 608879769 608882064 2295 True 4089 4089 98.783 1 2300 1 chr6A.!!$R1 2299
3 TraesCS3B01G122200 chr6A 84435316 84437618 2302 False 4023 4023 98.221 1 2300 1 chr6A.!!$F1 2299
4 TraesCS3B01G122200 chr6B 596621495 596623797 2302 False 4084 4084 98.697 1 2300 1 chr6B.!!$F1 2299
5 TraesCS3B01G122200 chr2B 30667144 30669441 2297 True 4052 4052 98.479 1 2300 1 chr2B.!!$R1 2299
6 TraesCS3B01G122200 chr4D 123424886 123427181 2295 False 4039 4039 98.392 1 2300 1 chr4D.!!$F1 2299
7 TraesCS3B01G122200 chr6D 168767960 168770257 2297 False 4019 4019 98.217 1 2300 1 chr6D.!!$F1 2299
8 TraesCS3B01G122200 chr5B 567267129 567269423 2294 True 3999 3999 98.088 1 2300 1 chr5B.!!$R1 2299

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
589 603 0.606096 TGTAGGCGAGCAAGTTAGCA 59.394 50.0 0.0 0.0 36.85 3.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2023 2044 3.128242 CGACTACTCATTACGGAACCACT 59.872 47.826 0.0 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
398 412 8.608317 GTCTCACTATTGGAAATTCTAGCTTTC 58.392 37.037 0.00 8.37 32.92 2.62
399 413 8.543774 TCTCACTATTGGAAATTCTAGCTTTCT 58.456 33.333 13.80 2.38 33.93 2.52
400 414 9.171877 CTCACTATTGGAAATTCTAGCTTTCTT 57.828 33.333 13.80 5.95 33.93 2.52
401 415 9.520515 TCACTATTGGAAATTCTAGCTTTCTTT 57.479 29.630 13.80 0.00 33.93 2.52
589 603 0.606096 TGTAGGCGAGCAAGTTAGCA 59.394 50.000 0.00 0.00 36.85 3.49
635 649 1.074872 GGTGCGTACGTAGCCTTCAC 61.075 60.000 22.55 15.95 0.00 3.18
663 677 3.650139 ACGCTACACAAAGTCACTTAGG 58.350 45.455 0.00 0.00 0.00 2.69
1052 1072 4.645651 GGAGTTTCCTTAGGTAGCCACCA 61.646 52.174 3.54 0.00 39.47 4.17
2023 2044 4.262036 CGGGAAGTCTAATCGGATCAATCA 60.262 45.833 0.00 0.00 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
410 424 3.131396 GTTGACAAAGAAGAAGAGCCGA 58.869 45.455 0.00 0.00 0.00 5.54
589 603 5.365314 CACTCTCTTATCCCTAAGCCTCTTT 59.635 44.000 0.00 0.00 35.32 2.52
635 649 5.087397 GTGACTTTGTGTAGCGTAGTAGAG 58.913 45.833 0.00 0.00 0.00 2.43
663 677 7.965107 TCCTTTACTCTCTTAATTAACGTCGAC 59.035 37.037 5.18 5.18 0.00 4.20
1025 1045 4.383880 GGCTACCTAAGGAAACTCCGATTT 60.384 45.833 0.00 0.00 42.75 2.17
1052 1072 7.147532 ACAGAAGTTTAAGGAGAACTGTAGGTT 60.148 37.037 0.00 0.00 37.41 3.50
1275 1295 3.963428 AACAAGAAGTCACGCCTAGAT 57.037 42.857 0.00 0.00 0.00 1.98
2023 2044 3.128242 CGACTACTCATTACGGAACCACT 59.872 47.826 0.00 0.00 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.