Multiple sequence alignment - TraesCS3B01G122100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G122100 chr3B 100.000 2327 0 0 1 2327 92297673 92295347 0.000000e+00 4298.0
1 TraesCS3B01G122100 chr3B 98.584 2330 27 4 1 2327 6011707 6009381 0.000000e+00 4115.0
2 TraesCS3B01G122100 chr3B 88.120 1271 125 19 592 1848 22162582 22163840 0.000000e+00 1487.0
3 TraesCS3B01G122100 chr3B 93.088 897 55 6 1431 2325 342687462 342688353 0.000000e+00 1306.0
4 TraesCS3B01G122100 chr3B 93.407 91 6 0 103 193 690022037 690022127 4.030000e-28 135.0
5 TraesCS3B01G122100 chr3B 90.909 77 7 0 41 117 743129784 743129708 1.140000e-18 104.0
6 TraesCS3B01G122100 chr3B 98.039 51 1 0 2220 2270 21186278 21186328 3.180000e-14 89.8
7 TraesCS3B01G122100 chr4D 98.929 2334 18 3 1 2327 123449927 123447594 0.000000e+00 4165.0
8 TraesCS3B01G122100 chr3A 98.884 2330 21 3 1 2327 495105701 495103374 0.000000e+00 4154.0
9 TraesCS3B01G122100 chr2B 98.798 2330 23 3 1 2327 234542101 234539774 0.000000e+00 4143.0
10 TraesCS3B01G122100 chrUn 98.584 2330 27 4 1 2327 217906727 217909053 0.000000e+00 4115.0
11 TraesCS3B01G122100 chr4A 98.584 2330 28 3 1 2327 67518557 67520884 0.000000e+00 4115.0
12 TraesCS3B01G122100 chr7A 98.498 2330 30 3 1 2327 563523039 563520712 0.000000e+00 4104.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G122100 chr3B 92295347 92297673 2326 True 4298 4298 100.000 1 2327 1 chr3B.!!$R2 2326
1 TraesCS3B01G122100 chr3B 6009381 6011707 2326 True 4115 4115 98.584 1 2327 1 chr3B.!!$R1 2326
2 TraesCS3B01G122100 chr3B 22162582 22163840 1258 False 1487 1487 88.120 592 1848 1 chr3B.!!$F2 1256
3 TraesCS3B01G122100 chr3B 342687462 342688353 891 False 1306 1306 93.088 1431 2325 1 chr3B.!!$F3 894
4 TraesCS3B01G122100 chr4D 123447594 123449927 2333 True 4165 4165 98.929 1 2327 1 chr4D.!!$R1 2326
5 TraesCS3B01G122100 chr3A 495103374 495105701 2327 True 4154 4154 98.884 1 2327 1 chr3A.!!$R1 2326
6 TraesCS3B01G122100 chr2B 234539774 234542101 2327 True 4143 4143 98.798 1 2327 1 chr2B.!!$R1 2326
7 TraesCS3B01G122100 chrUn 217906727 217909053 2326 False 4115 4115 98.584 1 2327 1 chrUn.!!$F1 2326
8 TraesCS3B01G122100 chr4A 67518557 67520884 2327 False 4115 4115 98.584 1 2327 1 chr4A.!!$F1 2326
9 TraesCS3B01G122100 chr7A 563520712 563523039 2327 True 4104 4104 98.498 1 2327 1 chr7A.!!$R1 2326

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
425 426 4.236443 TTCCTTACCGGGAAGGCA 57.764 55.556 37.27 27.17 44.98 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2193 2206 1.071471 CTGTGCGTGGGAGTTTCCT 59.929 57.895 0.0 0.0 36.57 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
425 426 4.236443 TTCCTTACCGGGAAGGCA 57.764 55.556 37.27 27.17 44.98 4.75
991 992 7.652909 TCGAATTTCAAATCATTCACTTGCTTT 59.347 29.630 0.00 0.00 30.84 3.51
1486 1498 1.218316 GGGGACAGCGTAAGTGAGG 59.782 63.158 0.00 0.00 41.68 3.86
2193 2206 4.693283 AGAATGATTCGAGCCGTATGAAA 58.307 39.130 0.00 0.00 34.02 2.69
2207 2220 1.534729 ATGAAAGGAAACTCCCACGC 58.465 50.000 0.00 0.00 42.68 5.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
425 426 3.244387 GGCCAGAAGAAGAAGAGAAGTGT 60.244 47.826 0.0 0.0 0.00 3.55
959 960 9.778993 AGTGAATGATTTGAAATTCGAGTTATG 57.221 29.630 0.0 0.0 35.89 1.90
991 992 5.012046 CCCACATCCATAGCATGAGTAGTTA 59.988 44.000 0.0 0.0 0.00 2.24
1486 1498 2.084546 GACTGGGCTTACACACATTCC 58.915 52.381 0.0 0.0 0.00 3.01
2193 2206 1.071471 CTGTGCGTGGGAGTTTCCT 59.929 57.895 0.0 0.0 36.57 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.