Multiple sequence alignment - TraesCS3B01G122000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G122000 chr3B 100.000 2192 0 0 1 2192 92296734 92294543 0 4048
1 TraesCS3B01G122000 chr3B 97.950 2195 39 4 1 2192 6010768 6008577 0 3799
2 TraesCS3B01G122000 chr4D 98.408 2199 28 3 1 2192 123448988 123446790 0 3860
3 TraesCS3B01G122000 chr3A 98.223 2195 34 3 1 2192 495104762 495102570 0 3832
4 TraesCS3B01G122000 chr2B 98.132 2195 36 3 1 2192 234541162 234538970 0 3821
5 TraesCS3B01G122000 chr1A 98.041 2195 37 4 1 2192 278521192 278523383 0 3810
6 TraesCS3B01G122000 chrUn 97.950 2195 39 4 1 2192 217907666 217909857 0 3799
7 TraesCS3B01G122000 chr1B 97.904 2195 40 4 1 2192 619195333 619193142 0 3794
8 TraesCS3B01G122000 chr4A 97.722 2195 45 3 1 2192 67519496 67521688 0 3771


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G122000 chr3B 92294543 92296734 2191 True 4048 4048 100.000 1 2192 1 chr3B.!!$R2 2191
1 TraesCS3B01G122000 chr3B 6008577 6010768 2191 True 3799 3799 97.950 1 2192 1 chr3B.!!$R1 2191
2 TraesCS3B01G122000 chr4D 123446790 123448988 2198 True 3860 3860 98.408 1 2192 1 chr4D.!!$R1 2191
3 TraesCS3B01G122000 chr3A 495102570 495104762 2192 True 3832 3832 98.223 1 2192 1 chr3A.!!$R1 2191
4 TraesCS3B01G122000 chr2B 234538970 234541162 2192 True 3821 3821 98.132 1 2192 1 chr2B.!!$R1 2191
5 TraesCS3B01G122000 chr1A 278521192 278523383 2191 False 3810 3810 98.041 1 2192 1 chr1A.!!$F1 2191
6 TraesCS3B01G122000 chrUn 217907666 217909857 2191 False 3799 3799 97.950 1 2192 1 chrUn.!!$F1 2191
7 TraesCS3B01G122000 chr1B 619193142 619195333 2191 True 3794 3794 97.904 1 2192 1 chr1B.!!$R1 2191
8 TraesCS3B01G122000 chr4A 67519496 67521688 2192 False 3771 3771 97.722 1 2192 1 chr4A.!!$F1 2191

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
547 550 1.218316 GGGGACAGCGTAAGTGAGG 59.782 63.158 0.0 0.0 41.68 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1666 1674 1.12053 TCCGAGATGGAGCTTAACCC 58.879 55.0 0.0 0.0 43.74 4.11 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
52 53 7.652909 TCGAATTTCAAATCATTCACTTGCTTT 59.347 29.630 0.00 0.00 30.84 3.51
547 550 1.218316 GGGGACAGCGTAAGTGAGG 59.782 63.158 0.00 0.00 41.68 3.86
1254 1258 4.693283 AGAATGATTCGAGCCGTATGAAA 58.307 39.130 0.00 0.00 34.02 2.69
1268 1272 1.534729 ATGAAAGGAAACTCCCACGC 58.465 50.000 0.00 0.00 42.68 5.34
1414 1422 3.514777 CGAAGAGCAGCACCTTACA 57.485 52.632 0.00 0.00 0.00 2.41
1626 1634 0.392706 TATCCATGGAATCGTGCGCT 59.607 50.000 20.67 0.61 0.00 5.92
1666 1674 1.892468 CCGTTCTTAACCGAGACTCG 58.108 55.000 18.08 18.08 40.07 4.18
2104 2113 3.132289 CCGTCCCATTCTTTAGTGAGCTA 59.868 47.826 0.00 0.00 0.00 3.32
2145 2154 1.127951 CGGAAAACGCGTCAAGCTATT 59.872 47.619 14.44 0.00 45.59 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 9.778993 AGTGAATGATTTGAAATTCGAGTTATG 57.221 29.630 0.00 0.00 35.89 1.90
52 53 5.012046 CCCACATCCATAGCATGAGTAGTTA 59.988 44.000 0.00 0.00 0.00 2.24
547 550 2.084546 GACTGGGCTTACACACATTCC 58.915 52.381 0.00 0.00 0.00 3.01
1254 1258 1.071471 CTGTGCGTGGGAGTTTCCT 59.929 57.895 0.00 0.00 36.57 3.36
1414 1422 4.785301 AGATCCGATTGGTCATGAACATT 58.215 39.130 15.62 11.43 36.30 2.71
1626 1634 3.871006 GGCGATGATCTATGTTTCACACA 59.129 43.478 0.00 0.00 40.71 3.72
1636 1644 4.557205 GGTTAAGAACGGCGATGATCTAT 58.443 43.478 16.62 5.54 0.00 1.98
1666 1674 1.120530 TCCGAGATGGAGCTTAACCC 58.879 55.000 0.00 0.00 43.74 4.11
2006 2015 3.244875 TGAAGCACCACCATGAACACTAT 60.245 43.478 0.00 0.00 0.00 2.12
2010 2019 1.608055 CTGAAGCACCACCATGAACA 58.392 50.000 0.00 0.00 0.00 3.18
2015 2024 1.341383 GGAATCCTGAAGCACCACCAT 60.341 52.381 0.00 0.00 0.00 3.55
2104 2113 2.297597 GTGGATAAGATGGTAGCGCTCT 59.702 50.000 16.34 0.28 0.00 4.09
2112 2121 3.267483 CGTTTTCCGTGGATAAGATGGT 58.733 45.455 0.00 0.00 0.00 3.55
2151 2160 4.455124 CTTTTCTTTTAGTGCTTCGACCG 58.545 43.478 0.00 0.00 0.00 4.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.