Multiple sequence alignment - TraesCS3B01G121900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G121900 chr3B 100.000 3005 0 0 1 3005 92264439 92267443 0 5550
1 TraesCS3B01G121900 chr3B 98.802 3005 35 1 1 3005 92145508 92148511 0 5349
2 TraesCS3B01G121900 chr7B 99.135 3005 26 0 1 3005 698142744 698145748 0 5406
3 TraesCS3B01G121900 chr6B 98.902 3006 32 1 1 3005 128914699 128917704 0 5367
4 TraesCS3B01G121900 chr2A 98.869 3005 34 0 1 3005 563259224 563262228 0 5361
5 TraesCS3B01G121900 chr2A 98.702 3005 39 0 1 3005 735139375 735142379 0 5334
6 TraesCS3B01G121900 chr5B 98.802 3006 35 1 1 3005 713079637 713076632 0 5350


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G121900 chr3B 92264439 92267443 3004 False 5550 5550 100.000 1 3005 1 chr3B.!!$F2 3004
1 TraesCS3B01G121900 chr3B 92145508 92148511 3003 False 5349 5349 98.802 1 3005 1 chr3B.!!$F1 3004
2 TraesCS3B01G121900 chr7B 698142744 698145748 3004 False 5406 5406 99.135 1 3005 1 chr7B.!!$F1 3004
3 TraesCS3B01G121900 chr6B 128914699 128917704 3005 False 5367 5367 98.902 1 3005 1 chr6B.!!$F1 3004
4 TraesCS3B01G121900 chr2A 563259224 563262228 3004 False 5361 5361 98.869 1 3005 1 chr2A.!!$F1 3004
5 TraesCS3B01G121900 chr2A 735139375 735142379 3004 False 5334 5334 98.702 1 3005 1 chr2A.!!$F2 3004
6 TraesCS3B01G121900 chr5B 713076632 713079637 3005 True 5350 5350 98.802 1 3005 1 chr5B.!!$R1 3004

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
706 707 2.537401 GAGGCTCGCGTAGTTTGTTAT 58.463 47.619 5.77 0.0 0.0 1.89 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2630 2633 2.481289 AGAAAGAAAGCTTAGCCGCT 57.519 45.0 0.0 0.0 43.31 5.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 3.615155 GCTTCTTCACAAGCTTATCCCT 58.385 45.455 0.00 0.00 44.71 4.20
706 707 2.537401 GAGGCTCGCGTAGTTTGTTAT 58.463 47.619 5.77 0.00 0.00 1.89
1239 1240 3.769739 ACCATGGTGTCGCATATACAT 57.230 42.857 18.99 0.00 0.00 2.29
1423 1424 2.775890 CTGCGCCATCTCTTCCAATAT 58.224 47.619 4.18 0.00 0.00 1.28
1876 1878 4.946157 CCAATGTCCTTCTAGCTTCAACAT 59.054 41.667 0.00 0.00 0.00 2.71
2002 2004 3.403038 CACGTGAACCCTGAGAAATCTT 58.597 45.455 10.90 0.00 0.00 2.40
2085 2087 6.159293 TGACTATGATAGTGAATGATTCCGC 58.841 40.000 10.29 0.00 39.59 5.54
2306 2309 7.099120 GTCAAACCTGAAAAAGAATATGGCAT 58.901 34.615 4.88 4.88 31.88 4.40
2557 2560 2.897350 TCTATCCGGGCCTAAATGCTA 58.103 47.619 0.84 0.00 0.00 3.49
2594 2597 7.818997 TCACTCTACTTCTTACTGACTTTCA 57.181 36.000 0.00 0.00 0.00 2.69
2810 2813 2.172679 GAGGGAGAGAAGACGGTTCTT 58.827 52.381 4.02 0.00 45.35 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 3.646715 CGGACAGGAAAGGGGGCA 61.647 66.667 0.00 0.0 0.00 5.36
794 795 4.679639 CGATATCAAAGGTTGACCCTCGAA 60.680 45.833 3.12 0.0 45.47 3.71
1423 1424 9.643693 AGCTAACGCTTTAAAAAGTAGTACATA 57.356 29.630 2.52 0.0 46.47 2.29
2002 2004 5.011431 CACCATCTGCACTGAGGAATATCTA 59.989 44.000 0.00 0.0 0.00 1.98
2085 2087 7.667557 TGAATAGGTTACTCTATCCAATTCCG 58.332 38.462 0.00 0.0 0.00 4.30
2306 2309 7.958016 TCATTCCTCCCTATATTCAATCTCTCA 59.042 37.037 0.00 0.0 0.00 3.27
2594 2597 7.817962 GTGTTAAGCACATAGGATATATTCGGT 59.182 37.037 0.00 0.0 46.91 4.69
2630 2633 2.481289 AGAAAGAAAGCTTAGCCGCT 57.519 45.000 0.00 0.0 43.31 5.52
2810 2813 0.034380 AGAGATGTCTTCCGTCCCGA 60.034 55.000 0.00 0.0 0.00 5.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.