Multiple sequence alignment - TraesCS3B01G121800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS3B01G121800 chr3B 100.000 2831 0 0 1 2831 92261854 92264684 0 5228
1 TraesCS3B01G121800 chr3B 98.235 2833 47 3 1 2831 92142922 92145753 0 4951
2 TraesCS3B01G121800 chrUn 98.836 2834 29 4 1 2831 223706936 223704104 0 5048
3 TraesCS3B01G121800 chr2A 98.798 2829 29 5 1 2826 605912879 605910053 0 5031
4 TraesCS3B01G121800 chr7B 98.694 2834 32 4 1 2831 698140158 698142989 0 5024
5 TraesCS3B01G121800 chr1B 98.694 2834 31 4 1 2831 683734144 683731314 0 5024
6 TraesCS3B01G121800 chr1B 98.131 2836 47 5 1 2831 338892815 338895649 0 4939
7 TraesCS3B01G121800 chr1B 98.059 2834 50 5 1 2831 583536773 583533942 0 4924
8 TraesCS3B01G121800 chr5B 98.236 2834 42 5 1 2831 713082220 713079392 0 4950


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS3B01G121800 chr3B 92261854 92264684 2830 False 5228 5228 100.000 1 2831 1 chr3B.!!$F2 2830
1 TraesCS3B01G121800 chr3B 92142922 92145753 2831 False 4951 4951 98.235 1 2831 1 chr3B.!!$F1 2830
2 TraesCS3B01G121800 chrUn 223704104 223706936 2832 True 5048 5048 98.836 1 2831 1 chrUn.!!$R1 2830
3 TraesCS3B01G121800 chr2A 605910053 605912879 2826 True 5031 5031 98.798 1 2826 1 chr2A.!!$R1 2825
4 TraesCS3B01G121800 chr7B 698140158 698142989 2831 False 5024 5024 98.694 1 2831 1 chr7B.!!$F1 2830
5 TraesCS3B01G121800 chr1B 683731314 683734144 2830 True 5024 5024 98.694 1 2831 1 chr1B.!!$R2 2830
6 TraesCS3B01G121800 chr1B 338892815 338895649 2834 False 4939 4939 98.131 1 2831 1 chr1B.!!$F1 2830
7 TraesCS3B01G121800 chr1B 583533942 583536773 2831 True 4924 4924 98.059 1 2831 1 chr1B.!!$R1 2830
8 TraesCS3B01G121800 chr5B 713079392 713082220 2828 True 4950 4950 98.236 1 2831 1 chr5B.!!$R1 2830

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
602 603 2.378038 AGAGTCTCATGAGCTCCTGAC 58.622 52.381 28.48 18.04 34.41 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1956 1961 0.392461 GCGAGGCTTACACCCATTCA 60.392 55.0 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
75 76 4.091549 CAATCAGCCCATAGCCCAATATT 58.908 43.478 0.00 0.00 45.47 1.28
370 371 6.819146 TCATATTGGTGACGTTATTGTTGCTA 59.181 34.615 0.00 0.00 0.00 3.49
602 603 2.378038 AGAGTCTCATGAGCTCCTGAC 58.622 52.381 28.48 18.04 34.41 3.51
688 689 6.673106 AGTAGATTGTGTCTGACGCATATAG 58.327 40.000 23.11 0.00 38.53 1.31
757 761 7.677454 TCTTAATAAAAGGAAGGGTTCGAAC 57.323 36.000 20.14 20.14 0.00 3.95
1721 1726 9.448294 GAAGATGAATCTTTCTATTTCACATGC 57.552 33.333 6.98 0.00 46.47 4.06
2014 2019 1.274728 GCTGACCACACTGAGAGACAT 59.725 52.381 0.00 0.00 0.00 3.06
2067 2072 1.472728 CGTTAAGCATCCCTAGCGGTT 60.473 52.381 0.00 0.00 37.01 4.44
2107 2113 6.812879 ATGATATCATCTACGTTCGTACCA 57.187 37.500 12.62 0.00 28.78 3.25
2230 2236 1.037493 GAACGGGCTTCCCAAAAAGT 58.963 50.000 2.47 0.00 45.83 2.66
2281 2288 3.259592 GGACGGCCCTAATGTTGTT 57.740 52.632 0.00 0.00 0.00 2.83
2497 2504 4.182693 TGGAATAGAAAGAACGCGAAGA 57.817 40.909 15.93 0.00 0.00 2.87
2607 2614 3.615155 GCTTCTTCACAAGCTTATCCCT 58.385 45.455 0.00 0.00 44.71 4.20
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 1.280133 CCTCTTGTGATTGGGCTCTCA 59.720 52.381 0.00 0.00 0.00 3.27
75 76 5.692115 TTGAATAATAGGCTGTGGTCTCA 57.308 39.130 0.00 0.00 0.00 3.27
370 371 3.700538 TGGGCACTGCTTCTTTGATTAT 58.299 40.909 0.00 0.00 0.00 1.28
757 761 9.477484 AGTTTTCGGTAATATTAGTAGATGCTG 57.523 33.333 0.00 0.00 0.00 4.41
1449 1453 3.202829 AGTGTTTGGCCTTTACTTCGA 57.797 42.857 3.32 0.00 0.00 3.71
1581 1586 0.597637 AACAAGCACCACTCGACGAG 60.598 55.000 22.97 22.97 35.52 4.18
1665 1670 1.329256 AGTAGTCGTGACCAACAGCT 58.671 50.000 0.00 0.00 0.00 4.24
1721 1726 4.142534 CCAACATAAAGATGCACACTCCTG 60.143 45.833 0.00 0.00 36.43 3.86
1827 1832 2.036475 CCCGGATCGAATCAGAGTTCAT 59.964 50.000 0.73 0.00 0.00 2.57
1949 1954 4.705023 AGGCTTACACCCATTCACATTAAC 59.295 41.667 0.00 0.00 0.00 2.01
1956 1961 0.392461 GCGAGGCTTACACCCATTCA 60.392 55.000 0.00 0.00 0.00 2.57
2067 2072 1.618343 TCATCACGACCTCTCTTTGCA 59.382 47.619 0.00 0.00 0.00 4.08
2335 2342 3.430374 GGAATGGCTCTCTTAGTTACGCA 60.430 47.826 0.00 0.00 0.00 5.24
2497 2504 1.310933 CGCTCATCCCTTGCTTGCTT 61.311 55.000 0.00 0.00 0.00 3.91
2572 2579 1.098050 AGAAGCAAGCTTATTGCCCG 58.902 50.000 7.37 0.00 45.98 6.13
2607 2614 3.646715 CGGACAGGAAAGGGGGCA 61.647 66.667 0.00 0.00 0.00 5.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.